liver_either_comp303_c0_seq3_reversed (mRNA) Phascolarctos cinereus

Feature Details
Name liver_either_comp303_c0_seq3_reversed
Unique Name liver_either_comp303_c0_seq3_reversed
Internal ID 1622111
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 398
Sequence
The sequence for this mRNA
GCGCGCTAATAGCTAATAAAGTCCACAATTTAAAATTAGCTTGGGTCGTCAACTCGCCTA
TAGGGATGAGAGTGGCCCCAGGAGACTCAAGGAAAGGTTAGATAAGAGGCAGTTAGAGCA
CCAAAAGAATTTAAGTTGGTACGAGGGATGGTTCAACCGTTCCCCCTGGCTTACTACTTT
ACTGTCTGCCCTTGCTGGTCCCCTGCTACTCCTCCTTCTGTTACTCACCCTCGGGCCTTG
TGTCATCAATAAGTTAGTGCAATTCATCAATGATAGGGTTAGTGCAGTAAGGATTCTGGT
TCTCAGGCACAAGTACCAGACCCTAGACAACGAGGATAACCTTTAATTCTGCTCTATGAT
TAGAGCTACCCTCAAAGAAAATGGGGGAATGAAGGAGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
trinity assembly of QUT KoRV RNASeq data 2014-03-12
Resources