liver_comp12_c0_seq7_reversed (mRNA) Phascolarctos cinereus

Feature Details
Name liver_comp12_c0_seq7_reversed
Unique Name liver_comp12_c0_seq7_reversed
Internal ID 1622106
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 2818
Sequence
The sequence for this mRNA
CCCGGCGCGCCAGTCCCTCTAGGTGACTGAGTCGCCCGAGTACTCGTAAGTTCAATAAAC
CTCTTGCTATTTGCATCCGGAGTTGTGTTCGCGTTGATCCTGGGAGGGTTTCTCAAGGTC
GGAGGACTACCCGAACATTGGGGTCTTTCATTTGGGGGCTCGTCCGGGATCTGAGATTCC
CACCCAAGGACCGCCGAACCACCGACGGGAGGCTTTAGAGGTTGTGAGGACTCAGATCTG
GGACCAGATAAAAGAAGCCTACAGGCCTGGTACTGTGGCCATTCCCCACCCGTTCCAGGT
CGGTGACCGAGTGCTGGTTAGACGTCATCGGTCCGGCAGCCTTGAGCCTCGGTGGAAAGG
CCCATACCTGGTGCTACTGACCACCCCGACCGCGGTGAAGGTTGACGGTATTGCTGCCTG
GGTCCATGCTTCTCATCTCAAACCCGCGCCACCTGGGGCACCCGATGAGTCCTGGGAACT
GGAAAAGACTGATCATCCTCTTAAGTTGCGTGTTCGGCGGCGCCGAAATGAATCAACAGC
ATAACAACCCTCACCAACCCATGACTCTCACCTGGCAGGTACTGTCCCAGACGGGAAGTG
TCGTTTGGGAAAAGAAAGCAGTCGAGCCACCCTGGACGTGGTGGCCCTCTCTTGAGCCTG
ATGTGTGCGCGCTGGTAGCCGGTCTCGAGTCCTGGGACATCCCGGAACTCACTGCATCGG
CCTCTCAACAGGCCAGACCACCCTTGTATGACCGACCTTGGGGGACCCCGGGAGCTGGTT
TTGCAGCCGCCGGGTGGGGAGGAACCCTGGGATGTAGCTATCCCCGGGCCAGAACAAGAA
TTGCTAGGTCCCAGTTCTACGTGTGCCCCCGGGATGGCCGTTCCCTGTCCGAGGCCCGGA
GGTGCGGAGGACTTGAATCTTTGTACTGTAAAGAGTGGGGTTGTGAGACCGCGGGAACCG
CCTACTGGCAACCCCGGTCCTCGTGGGACCTTATAACTGTAGGCCAGGGTCACCCTACAG
GGACATGCGAGCGCACCGGTTGGTGCAACCCACTCAAGATAGAGTTCACCGAGCCTGGCA
AACGGTTCCGAAACTGGCTACAGGGGCGAACCTGGGGTCTAAGGTTCTATGTGACTGGAC
ACCCAGGCGTGCAGTTGACCATACGACTAGTGATCACAAGTCCCCCACCGGTAGTAGTGG
GCCCCGATCCTGTCCTCGCAGAACAAGGACCTCCCAGAAAAATTCCCTTCCTCCCCAGAG
TGCCGGTTCCTACCCTATCACCCCCAGCGTCCCCTATCCCCACGGTACAGGCTAGCCCCC
CGGCCCCTAGTACTCCATCTCCCACCACGGGCGACCGGCTCTTTGGCCTCGTACAAGGGG
CCTTTCTGGCCTTGAATGCCACCAACCCGGAGGCCACGGAGTCTTGCTGGCTCTGTCTAG
CCCTCGGCCCTCCTTATTACGAAGGAATCGCAACTCCAGGGCAAGTCACTTATGCCTCCA
CAGATTCCCAATGTCGCTGGGGAGGAAAAGGGAAGCTCACCCTCACTGAAGTCTCTGGAC
TCGGGTTATGTATAGGGAAAGTACCTCCTACTCACCAACATCTCTGCAACCTGACTATAC
CCTTAAACGCCTCACATACTCACAAGTACCTCCTCCCCTCCAACCACAGCTGGTGGGCTT
GTAATTCTGGCCTCACCCCCTGCCTCTCTACATCAGTCTTCAACCAGTCTAACGATTTCT
GTATCCAGATCCAGCTTGTCCCTCGCATCTACTATCACCCAGACGGTACCTTGCTACAGG
CCTATGAGTCCCCCCACCCTAGAAACAAGAGAGAGCCTGTCTCACTCACCCTGGCTGTCC
TTCTCGGATTAGGGGTCGCAGCAGGTATAGGTACCGGCTCGACCGCCCTAATAAAAGGGC
CCATAGACCTCCAACAAGGTTTGACTAGCCTCCAGATTGCCATGGATACAGACCTTAGGG
CCCTTCAAGACTCCATAAGTAAACTAGAGGATTCCTTAACCTCCCTGTCTGAAGTAGTGC
TCCAGAATAGGAGAGGCCTTGATCTGCTATTTTTGAAGGAAGGGGGCCTTTGTGCAGCCC
TAAAAGAGGAATGCTGTTTCTATGTTGACCACTCAGGCGCGGTGCGAGACTCCATGAGGA
GACTCAAGGAAAGGTTAGATAAGAGGCAGTTAGAGCACCAAAAGAATTTAAGTTGGTACG
AGGGATGGTTCAACCGTTCCCCCTGGCTTACTACTTTACTGTCTGCCCTTGCTGGTCCCC
TGCTACTCCTCCTTCTGTTACTCACCCTCGGGCCTTGTGTCATCAATAAGTTAGTGCAAT
TCATCAATGATAGGGTTAGTGCAGTAAGGATTCTGGTTCTCAGGCACAAGTACCAGACCC
TAGACAACGAGGATAACCTTTAATTCTGCTCTATGATTAGAGCTACCCTCAAAGAAAATG
GGGGAATGAAGGAGGCAGAAATCATGAGGCAGAAATCATTCCGTGGAGTATGGAAACTAC
CCGGAGGGCCCAAGGTTTAGGGACAGGTGCAGCCAGGCACAGTAAAAGGTCAGAGCAAGA
AAAACAAGGAAGATTTGGAGTGCCAAACGGGATATCTGTGGTCATGCACCTGAGTCCCCA
CCCCGGACTTATGCAAACAATTCCCAGAAATAGCTGAGCTCATAACAGTTTCTAGGGTGC
CCCTCAGCAGTTTCTAGAACCCTCTCGTGACCGGAGTTTTTATTCAAACTAACCAATGAT
CTTGCTCCTCGCTTCTGTACCCGCGCTTTTTTGCTATAAAATGAGACCAAAGAATCCA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
trinity assembly of QUT KoRV RNASeq data 2014-03-12
Resources