kidney_comp4_c0_seq1_reversed (mRNA) Phascolarctos cinereus

Feature Details
Name kidney_comp4_c0_seq1_reversed
Unique Name kidney_comp4_c0_seq1_reversed
Internal ID 1622099
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 8009
Sequence
The sequence for this mRNA
GAGGACACCCGGACCAGGTTCCCTACATCATAGTTTGGCAGGACCTCTCCAACAGCCCCC
CCCCATGGGTGCCACCCTTAGCCAAGATCGCCGTTGCCTCTGGTCAAGATAACGGGCGAA
AGTCGGCGGGGGGGAGGCCGTCCGCTCCTTCCCGGCTCCCCATCTACCCGGAGACGGACA
GCCTGTTCCTCCTCTCAGAACCCCCGCCCTATCCAACGTCCCCTCCACCTCCCCCAGCCC
CTCACGCGGCCAGACCAGCGCCAGGCCTAATGGCTGAGGGACTCGGCTCTGAGGGACCGG
CCGCTGGAACTAGGAGTCGCCGTCCCCGCAGTCCTACGGGTGACACTGGTCCTGACTCCA
CTGTGGCCCTGCCCCTCCGGGCCGTGGGACCCCCGGCCGAACCAAACGGCTTAGTCCCCT
TGCAATATTGGCCTTTCTCCTCAGCAGATCTCTATAATTGGAAATCTAATCATCCTTCTT
TTTCCGAGAATCCTACAGGACTCACGGGACTCCTTGAGTCCCTCATGTTTTCCCACCAGC
CTACTTGGGACGATTGCCAGCAGCTCCTGCAAGTCCTCTTTACCACCGAGGAAAGAGAAA
GGATTCTTTTGGAGGCTCGCAAGAACGTCCTTGGAGTTAACGGGGCCCCTACACAACTCG
AGAACCTCATTAATGAGGCCTTCCCCCTTAATCGACCTCAGTGGGATCACAACACGGCTG
AAGGTAGGGAGCGTCTCCTGGTCTACCGCCGGACTCTAGTGGCGGGTCTCAAAGGGGCAG
CAAGGCGCCCCACCAATTTGGCCAAGGTAAGAGAAGTCTTGCAGGGACCAACAGAACCCC
CGTCCGTTTTTCTAGAACGTCTAATGGAGGCTTATAGGAGATATACCCCATTTGATCCCT
CTTCTGAGGGACAAAAGGCGGCGGTGGCCATGTCCTTTATCGGACAGTCTGCCCCGGATA
TTAAAAAGAAATTACAAAGACTGGAAGGACTCCAGGACCATTCCTTGCAGGATCTCATAA
AGGAGGCAGAGAAGGTATATCATAAGAGAGAGACAGAGGAAGAAAAGCAAGAAAGAGAGA
AAAAGGAGACAGAGGAAAGAGAGAGACGGCGTGACAGGCGCCAGGAGAAAAACTTGACCA
AAATCTTGGCCGCGGTAGTAAGTGAGAAAGGGTCCAGAGGAAGACAGGCAGGGAATCTGA
GCAACAGGGCAATGAGGGCACCTAGGGAAGGAAGACCGCCTCTGGACAAAGATCAGTGCG
CATACTGTAAAGAAAGGGGCCATTGGGCAAGGGAGTGCCCCCGGAAGAAGAACGCCAGGG
AAACCAATGTCCTGACCCTGGGTGACTAGGGGAGTCGGGGTTCGGACCCCCTCCCCGAGC
CCAGGGTAACGTTAACTGTGGAGGGGATCCCCACTGAGTTTTTGGTTGATACCGGGGCCG
AACATTCAGTATTGACCAAGCCTATGGGAAAGATGGGACCCAAACGGACAGTCGTGGCTG
GGGCGACGGGCAGCAAAGTTTACCCTTGGACCACCAAGAGACTTTTGAAAATCGGACAAA
AGCAAGTGACCCACTCATTCTTGGTCATACCCGAATGCCCTGCTCCCCTGTTAGGCAGGG
ACCTCCTCACCAAGCTAAAAGCTCAAATCCAGTTTTCCACAGAGGGCCCACAGGTAACAT
GGGAAGACCGCCCCGCCATGTGTTTAGTCCTGAACTTGGAGGAGGAATACCGATTACACG
AAAAGCCGGTCCCTCCTTCTATCGACCCGTCATGGCTCCAACTCTTTCCCATGGTTTGGG
CCGAGAAGGCAGGTATGGGACTGGCCAATCAAGTCCCACCAGTGGTAGTGGAACTGAAGT
CAGATGCCTCACCAGTGGCTGTTCGACAGTACCCAATGAGCAAGGAAGCCCGGGAGGGTA
TCAGGCCCCACATCCAAAGATTCTTGGATTTGGGGATTCTGGTACCTTGCCAGTCGCCCT
GGAACACCCCTTTGTTACCTGTAAAAAAACCTGGAACCAATGACTATCGGCCAGTCCAAG
ATTTGAGGGAGGTCAACAAAAGAGTACAGGACATTCATCCCACAGTCCCGAACCCCTATA
ACCTACTCAGTTCCCTCCCGCCCAGCCACACCTGGTATTCAGTTTTAGACCTCAAAGATG
CTTTCTTTTGCCTCAAGCTACACCCCAACAGCCAGCCATTGTTCGCGTTTGAATGGAGAG
ATCCAGAAAAAGGCAATACTGGCCAGCTAACCTGGACTCGGCTACCGCAAGGATTCAAGA
ACTCTCCCACCCTCTTCGATGAGGCCCTCCACCGGGATCTGGCATCCTTCAGGGCTCTCA
ACCCCCAGGTAGTGATGCTCCAATATGTTGATGACCTCCTGGTAGCGGCCCCAACGTACC
GAGACTGCAAAGAAGGGACACGAAGGCTCTTACAGGAACTAAGTAAGTTGGGATACCGAG
TGTCGGCCAAAAAGGCCCAGCTTTGCCGGGAGGAAGTTACGTATCTCGGGTATTTGCTAA
AAGGGGGGAAGAGATGGCTGACCCCAGCCCGAAAGGCCACTGTAATGAAGATCCCCACCC
CTACAACCCCCAGACAAGTCCGTGAGTTTTTGGGCACTGCTGGATTCTGTAGGCTCTGGA
TCCCTGGTTTCGCTTCCCTGGCTGCACCCCTGTACCCCCTGACGAGAGAAAAGGTTCCCT
TTACCTGGACTGAGGCCCACCAGGAAGCCTTTGGCCGTATAAAAGAGGCCCTGCTATCGG
CCCCCGCCCTGGCCCTTCCGGACCTCACCAAGCCATTTGCTCTGTACGTGGATGAAAAAG
AGGGTGTTGCCCGGGGGGTGCTTACTCAAACCCTAGGACCATGGCGACGCCCGGTAGCTT
ACCTGTCAAAAAAATTAGATCCGGTGGCCAGTGGGTGGCCAACTTGCCTAAAAGCAATTG
CGGCCGTAGCACTCCTTCTCAAGGACGCTGATAAGTTAACCCTAGGACAGAACGTGTTGG
TGATTGCACCTCACAACCTGGAAAGTATTGTGAGACAGCCCCCCGACCGATGGATGACAA
ATGCCAGGATGACCCATTACCAAAGTCTGCTGCTGAATGAGAGGGTGTCTTTTGCGCCCC
CGGCCATTCTGAATCCTGCCACCCTGCTCCCCGTAGAGTCAGACGACACCCCAATACACA
TATGCTCAGAAATCCTTGCCGAGGAGACAGGAACCCGACCTGATCTGAGAGATCAGCCGT
TGCCCGGGGTACCCGCTTGGTATACGGATGGCAGCAGTTTCATCATGGATGGCAGGCGAC
AAGCAGGTGCTGCCATTGTGGACAACAAGCGGACGGTGTGGGCGAGCAACCTGCCAGAGG
GAACGTCAGCTCAGAAGGCCGAACTAATCGCCTTGACACAAGCATTACGCTTGGCCGAAG
GAAAAAGCATCAACATCTACACGGACAGCAGGTACGCTTTTGCCACCGCTCATGTTCACG
GGGCTATATACAAACAAAGAGGACTGCTCACCTCCGCTGGAAAAGACATCAAGAACAAAG
AGGAGATTTTGGCCCTGCTAGAGGCCATCCATCTCCCTAAGCGAGTCGCTATCATCCATT
GCCCCGGCCACCAAAGAGGGACTGACCCTGTGGCTACCGGAAACCGAAAGGCCGATGAGG
CCGCGAAACAAGCTGCCCAGTCAACCAGAATACTGACGGAGACCACGAAAAATCAAGAAC
ACTTCGAGCCTACACGGGGGAAGATCAAGCCGAGAGAGCTCACCCCTGACCAGGGAAGGG
AATTCATTCAACGGCTGCATCAGCTCACGCACTTAGGGCCAGACAAGCTTCTCCAGCTTG
TAGGTCGCACCAGTTTTCACATCCCGAATCTCCAGTCTGTAGTGCGTGAAATCACCAGCA
AGTGTCAGGTTTGTGCTGTAACTAACGCAGTCACCACCTACCGAGAGTCTGGAAGGAGGC
AAAGGGGAGATCGACCCGGCGTGTATTGGGAAGTAGACTTCACAGAGGTTAAGCCTGGCC
GGTATGGTAATAGATATTTGCTAGTGTTTATCGATACATTTTCTGGGTGGGTAGAAGCTT
TCCCTACAAAAACAGAGACAGCCCTGACCGTCTGCAAGAAGATACTTGAGGAAATCCTAC
CTCGTTTCGGGATCCCTAAGGTACTCGGGTCCGACAATGGCCCTGCCTTCGTTGCTCAGG
TAAGCCAGGGGTTGGCCACTCAACTGGGGATTGATTGGAAATTACATTGTGCATATAGAC
CCCAGAGCTCAGGTCAGGTAGAAAGGATGAATAGGACAATTAAAGAGACCTTGACAAAAT
TGGCCTTAGAGACCGGTGGAAAAGACTGGGTGACCCTCCTCCCTTTGGCGCTACTTAGGG
CCCGGAATACCCCTGGCCAGTTTGGCCTGACTCCTTATGAGATTCTTCATGGGGGGCCGC
CCCCTGTACTTGCGTCTGGGGAAGTCGTGGGTTCTAATGGTGATTTTTTTCCCGTTCTAT
TTACCCACTTGAAGGCTTTAGAGGTTGTGAGGACTCAGATCTGGGACCAGATAAAAGAAG
CCTACAGGCCTGGTACTGTGGCCATTCCCCACCCGTTCCAGGTCGGTGACCGAGTGCTGG
TTAGACGTCATCGGTCCGGCAGCCTTGAGCCTCGGTGGAAAGGCCCATACCTGGTGCTAC
TGACCACCCCGACCGCGGTGAAGGTTGACGGTATTGCTGCCTGGGTCCATGCTTCTCATC
TCAAACCCGCGCCACCTGGGGCACCCGATGAGTCCTGGGAACTGGAAAAGACTGATCATC
CTCTTAAGTTGCGTGTTCGGCGGCGCCGAAATGAATCAACAGCATAACAACCCTCACCAA
CCCATGACTCTCACCTGGCAGGTACTGTCCCAGACGGGAAGTGTCGTTTGGGAAAAGAAA
GCAGTCGAGCCACCCTGGACGTGGTGGCCCTCTCTTGAGCCTGATGTGTGCGCGCTGGTA
GCCGGTCTCGAGTCCTGGGACATCCCGGAACTCACTGCATCGGCCTCTCAACAGGCCAGG
CCCCCTGATTCAAACTATGAACATGCTTATAATCAGATCACTTGGGGAACCCTGGGATGT
AGCTATCCCCGGGCCAGAACAAGAATTGCTAGGTCCCAGTTCTACGTGTGCCCCCGGGAT
GGCCGTTCCCTGTCCGAGGCCCGGAGGTGCGGAGGACTTGAATCTTTGTACTGTAAAGAG
TGGGGTTGTGAGACCGCGGGAACCGCCTACTGGCAACCCCGGTCCTCGTGGGACCTTATA
ACTGTAGGCCAGGGTCACCCTACAGGGACATGCGAGCGCACCGGTTGGTGCAACCCACTC
AAGATAGAGTTCACCGAGCCTGGCAAACGGTTCCGAAACTGGCTACAGGGGCGAACCTGG
GGTCTAAGGTTCTATGTGACTGGACACCCAGGCGTGCAGTTGACCATACGACTAGTGATC
ACAAGTCCCCCACCGGTAGTAGTGGGCCCCGATCCTGTCCTCGCAGAACAAGGACCTCCC
AGAAAAATTCCCTTCCTCCCCAGAGTGCCGGTTCCTACCCTATCACCCCCAGCGTCCCCT
ATCCCCACGGTACAGGCTAGCCCCCCGGCCCCTAGTACTCCATCTCCCACCACGGGCGAC
CGGCTCTTTGGCCTCGTACAAGGGGCCTTTCTGGCCTTGAATGCCACCAACCCGGAGGCC
ACGGAGTCTTGCTGGCTCTGTCTAGCCCTCGGCCCTCCTTATTACGAAGGAATCGCAACT
CCAGGGCAAGTCACTTATGCCTCCACAGATTCCCAATGTCGCTGGGGAGGAAAAGGGAAG
CTCACCCTCACTGAAGTCTCTGGACTCGGGTTATGTATAGGGAAAGTACCTCCTACTCAC
CAACATCTCTGCAACCTGACTATACCCTTAAACGCCTCACATACTCACAAGTACCTCCTC
CCCTCCAACCACAGCTGGTGGGCTTGTAATTCTGGCCTCACCCCCTGCCTCTCTACATCA
GTCTTCAACCAGTCTAACGATTTCTGTATCCAGATCCAGCTTGTCCCTCGCATCTACTAT
CACCCAGACGGTACCTTGCTACAGGCCTATGAGTCCCCCCACCCTAGAAACAAGAGAGAG
CCTGTCTCACTCACCCTGGCTGTCCTTCTCGGATTAGGGGTCGCAGCAGGTATAGGTACC
GGCTCGACCGCCCTAATAAAAGGGCCCATAGACCTCCAACAAGGTTTGACTAGCCTCCAG
ATTGCCATGGATACAGACCTTAGGGCCCTTCAAGACTCCATAAGTAAACTAGAGGATTCC
TTAACCTCCCTGTCTGAAGTAGTGCTCCAGAATAGGAGAGGCCTTGATCTGCTATTTTTG
AAGGAAGGGGGCCTTTGTGCAGCCCTAAAAGAGGAATGCTGTTTCTATGTTGACCACTCA
GGCGCGGTGCGAGACTCCATGAGGAGACTCAAGGAAAGGTTAGATAAGAGGCAGTTAGAG
CACCAAAAGAATTTAAGTTGGTACGAGGGATGGTTCAACCGTTCCCCCTGGCTTACTACT
TTACTGTCTGCCCTTGCTGGTCCCCTGCTACTCCTCCTTCTGTTACTCACCCTCGGGCCT
TGTGTCATCAATAAGTTAGTGCAATTCATCAATGATAGGGTTAGTGCAGTAAGGATTCTG
GTTCTCAGGCACAAGTACCAGACCCTAGACAACGAGGATAACCTTTAATTCTGCTCTATG
ATTAGAGCTACCCTCAAAGAAAATGGGGGAATGAAGGAGGCAGAAATCATGAGGCAGAAA
TCATTCCGTGGAGTATGGAAACTACCCGGAGGGCCCAAGGTTTAGGGACAGGTGCAGCCA
GGCACAGTAAAAGGTCAGAGCAAGAAAAACAAGGAAGATTTGGAGTGCCAAACGGGATAT
CTGTGGTCATGCACCTGAGTCCCCACCCCGGACTTATGCAAACAATTCCCAGAAATAGCT
GAGCTCATAACAGTTTCTAGGGTGCCCCTCAGCAGTTTCTAGAACCCTCTCGTGACCGGA
GTTTTTATTCAAACTAACCAATGATCTTGCTCCTCGCTTCTGTACCCGCGCTTTTTTGCT
ATAAAATGAGACCAAAGAATCCACCCGGCGCGCCAGTCCCTCTAGGTGACTGAGTCGCCC
GAGTACTCGTAAGTTCAATAAACCTCTTGCTATTTGCATCCGGAGTTGTGTTCGCGTTGA
TCCTGGGAGGGTTTCTCAAGGTCGGAGGACTACCCGAACATTGGGGTCTTTCATTTGGGG
GCTCGTCCGGGATCTGAGATTCCCACCCAAGGACCGCCGAACCACCGACGGGAGGTAAGC
TGGCCAGCGATCGCTCTATGTTCTCTCTGTGTCTGACTCCGAAAACTCTGACTGTCTATT
CGGTGTGCGCGCATTTTTGGTTTCAGTTTATTCCGGGTTAATCGATCTAAGATCGAGGCG
TGAGTAGCGGACAGACGTGTTCGGGGGCTCACCGCCCGGCAATCCTGGGAGACGTCCCAG
GATCAGGGGAGGACCAGGGACGCCTGGTGGATCCCACGGCAAGGGATAATTCTCTTCTGA
TCTCACAGTTGCACTGTCTTGAGAGACATACCCTACCTTCTGACTCTTTTTCCTGTCTTT
TTAATATACGTCTACGCCGCCATATAATTTTTTTCCTTTTTATTTCAATAATAATCATTA
TCTGGGTCGTAATTCCACTCTTCGGGACCCCCAGAATGGGACAGGGTGAGTCGACCCCTC
TCTCTCTTACACTAGATCACTGGAAAGACGTGAAGACAAGGGCTCACAATCTTTCCGTGG
AGATAAGAAAGGGAAAGTGGCAAACCTTCTGTTCCTCCGAGTGGCCCACGTTCGAAGTGG
GATGGCCACCGGAGGGGACTTTTAATCCTTCTATTATTTCTGCAGTCAAAAGGATTGTCT
TCCAGGAGACTGTTGGACCTGGTGAAAGGGTCTAGAAAGAAGAAAGATTTTTTTATTGGG
TCAATTGTATTAGTTATGTTGCTGGAAGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
trinity assembly of QUT KoRV RNASeq data 2014-03-12
Resources