bonemarrow_v3_comp15_c0_seq1 (mRNA) Phascolarctos cinereus

Feature Details
Name bonemarrow_v3_comp15_c0_seq1
Unique Name bonemarrow_v3_comp15_c0_seq1
Internal ID 1622048
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1698
Sequence
The sequence for this mRNA
GCCCCCTGATTCAAACTATGAACATGCTTATAATCAGATCACTTGGGGAACCCTGGGATG
TAGCTATCCCCGGGCCAGAACAAGAATTGCTATGTCCCCATTCTACGTGTGCCCCCGGGA
TGGCCGTTCCCTGTCCGAGGCCCGGAGGTGCGGAGGACTTGAATCTTTGTATTGTAAAAA
GTGGGGTTGTGAGACCACGGGAACCGCCTACTGGCAACCCCGGTCCTCGTGGGACCTTAT
AACTGTAGGCCGGGGTCACCCTACAGGGACATGCGAGCACACCGGTTGGTGCAACCCACT
CAAGATAGAGTTCACCGAGCCTGGCAAACGATTCCGAAACTGGCTACAGGGGCGGACTTG
GGGTCTAAGGTTCTATGTGACTGGACACCCAGGCGTGCAGTTGACCATACGACTAGTGAT
CACAAGTCCCCCACCGGTAGTAGTGGGCCCCGATCCTGTCCTCGCAGAACAAGGACCTCC
CAGAGAAATTCCCTTCCTCCCCAGAGTGCCGGTTCCTACCCTATCACCCCCAGCGTCCCC
TATCCCCACGGTACAGGCTAGCCCCCCGGCCCCTAGTACTCCATCTCCCACCACGGGCGA
CCGGCTCTTTGGCCTCGTACAAGGGGCCTTTCTGGCCTTGAATGCCACCAACCCGGAGGC
CACGGAGTCTTGCTGGCTCTGTCTAGCCCTCGCCCCTCCTTATTACGAAGGAATCGCAAC
TCCAGGGCAAGTCACTTATGCCTCCACAGATTCCCAATGTCGCTGGGGAGGAAAAGGGAA
GCTCACCCTCACTGAAGTCTCTGGACTCGGGTTATGTATAGGGAAAGTACCTCCTACTCA
CCAACATCTCTGTAACCTGACTATACCCTTAAACGCCTCACATACTCACAAGTACCTCCT
CCCCTCCAACCACAGCTGGTGGGCTTGTAATTCTGGCCTCACCCCCTGCCTCTCTACATC
AGTCTTCAACCAGTCTAACGATTTCTGTATCCAGATCCAGCTTGTCCCTCGCATCTACTA
TCACCCAGACGGTACCTTGCTACAGGCCTATGAGTCCCCCCACCCTAGACACAAGAGAGA
GCCTGTCTCACTCACCCTGGCTGTCCTTCTCGGATTAGGGGTCGCAGCAGGTATAGGTAC
CGGCTCGACCGCCCTAATAAAAGGGCCCATAGACCTCCAACAAGGTTTGACCAGCCTCCA
GATTGCCATGGATACAGACCTTAGGGCCCTTCAAGACTCCATAAGTAAACTAGAGGATTC
CTTAACCTCCCTGTCTGAAGTGGTGCTCCAGAATAGGAGAGGCCTTGATCTGCTATTTTT
GAAGGAAGGGGGCCTTTGTGCAGCCCTAAAAGAGGAATGCTGTTTCTATGTTGACCACTC
AGGCGCGGTGCGAGACTCCATGAGGAGACTCAAGGAAAGGTTAGATAAGAGGCAGTTAGA
GCACCAAAAGAATTTAAGTTGGTACGAGGGATGGTTCAACCGTTCCCCCTGGCTTACTAC
TTTACTGTCTGCCCTTGCTGGTCCCCTGCTACTCCTCCTTCTGTTACTCACCCTCGGGCC
TTGTGTCATCAATAAGTTAGTGCAATTCATCAATGATAGGGTTAGTGCAGTAAGGATTCT
GGTTCTCAGGCACAAGTACCAGACCCTAGACAACGAGGATAACCTTTAATTCTGCTCTAT
GATTAGAGCTACCCTCAA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
trinity assembly of QUT KoRV RNASeq data 2014-03-12
Resources