bonemarrow_v2_3_comp374_c0_seq1 (mRNA) Phascolarctos cinereus

Feature Details
Name bonemarrow_v2_3_comp374_c0_seq1
Unique Name bonemarrow_v2_3_comp374_c0_seq1
Internal ID 1622047
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 2687
Sequence
The sequence for this mRNA
TTCCCTACAAAAACAGAGACAGCCCTGACCGTCTGCAAGAAGATACTTGAGGAAATCCTA
CCTCGTTTCGGGATCCCTAAGGTACTCGGGTCCGACAATGGCCCTGCCTTCGTTGCTCAG
GTAAGCCAGGGGTTGGCCACTCAACTGGGGATTAATTGGAAATTACATTGTGCATATAGA
CCCCAGAGCTCAGGTCAGGTAGAAAGGATGAATAGGACAATTAAAGAGACCTTGACAAAA
TTGGCCTTAGAGACCGGTGGAAAAGACTGGGTGACCCTCCTCCCTTTGGCGCTACTTAGG
GCCCGGAATACCCCTGGCCAGTTTGGCCTGACTCCTTATGAGATTCTTCATGGGGGGCCG
CCCCCTGTACTTGCATCTGGGGAAGTCGTGGGTTCTAATGGTGATTTTTTTCCCGTTCTA
TTTACCCACTTGAAGGCTTTAGAGGTTGTGAGGACTCAGATCTGGGACCAGATAAAAGAA
GCCTACAGGCCTGGTACTGTGGCCATTCCCCACCCGTTCCAGGTCGGTGACCGAGTGCTG
GTTAGACGTCATCGGTCCGGCAGCCTTGAGCCTCGGTGGAAAGGCCCATACCTGGTGCTA
CTGACCACCCCGACCGCGGTGAAGGTTGACGGTATTGCTGCCTGGGTCCATGCTTCTCAT
CTCAAACCCGCGCCACCCGGGGCACCCGATGAGTCCTGGGAACTGGAAAAGACTGATCAT
CCTCTTAAGTTGCGTGTTCGGCGGCGCCGAAATGAATCGACAGCATAACAACCCTCACCA
ACCCATGACTCTCACCTGGCAGGTACTGTCCCAGACGGGAAGTGTCGTTTGGGAAAAGAA
AGCAGTCGAGCCACCCTGGACGTGGTGGCCCTCTCTTGAGCCTGATGTGTGTGCGCTGGT
AGCCGGTCTCGAGTCCTGGGACATCCCGGAACTCACTGCATCGGCCTCTCAACAGGCCAG
ACCACCCTTGTATGACCGACCTTGGGGGACCCCGGGAGCTGGTTTTGCAGCCGCCGGGTG
GGGAGGAACCCTGGGATGTAGCTATCCCCGGGCCAGAACAAGAATTGCTATGTCCCCATT
CTACGTGTGCCCCCGGGATGGCCGTTCCCTGTCCGAGGCCCGGAGGTGCGGAGGACTTGA
ATCTTTGTACTGTAAAGAGTGGGGTTGTGAGACCGCGGGAACCGCCTACTGGCAACCCCG
GTCCTCGTGGGACCTTATAACTGTAGGCCGGGGTCACCCTACAGGGACATGCGAGCACAC
CGGTTGGTGCAACCCACTCAAGATAGAGTTCACCGAGCCTGGCAAACGATTCCGAAACTG
GCTACAGGGGCGGACTTGGGGTCTAAGGTTCTATGTGACTGGACACCCAGGCGTGCAGTT
GACCATACGACTAGTGATCACAAGTCCCCCACCGGTAGTAGTGGGCCCCGATCCTGTCCT
CGCAGAACAAGGACCTCCCAGAGAAATTCCCTTCCTCCCCAGAGTGCCGGTTCCTACCCT
ATCACCCCCAGCGTCCCCTATCCCCACGGTACAGGCTAGCCCCCCGGCCCCTAGTACTCC
ATCTCCCACCACGGGCGACCGGCTCTTTGGCCTCGTACAAGGGGCCTTTCTGGCCTTGAA
TGCCACCAACCCGGAGGCCACGGAGTCTTGCTGGCTCTGTCTAGCCCTCGCCCCTCCTTA
TTACGAAGGAATCGCAACTCCAGGGCAAGTCACTTATGCCTCCACAGATTCCCAATGTCG
CTGGGGAGGAAAAGGGAAGCTCACCCTCACTGAAGTCTCTGGACTCGGGTTATGTATAGG
GAAAGTACCTCCTACTCACCAACATCTCTGTAACCTGACTATACCCTTAAACGCCTCACA
TACTCACAAGTACCTCCTCCCCTCCAACCACAGCTGGTGGGCTTGTAATTCTGGCCTCAC
CCCCTGCCTCTCTACATCAGTCTTCAACCAGTCTAACGATTTCTGTATCCAGATCCAGCT
TGTCCCTCGCATCTACTATCACCCAGACGGTACCTTGCTACAGGCCTATGAGTCCCCCCA
CCCTAGACACAAGAGAGAGCCTGTCTCACTCACCCTGGCTGTCCTTCTCGGATTAGGGGT
CGCAGCAGGTATAGGTACCGGCTCGACCGCCCTAATAAAAGGGCCCATAGACCTCCAACA
AGGTTTGACCAGCCTCCAGATTGCCATGGATACAGACCTTAGGGCCCTTCAAGACTCCAT
AAGTAAACTAGAGGATTCCTTAACCTCCCTGTCTGAAGTGGTGCTCCAGAATAGGAGAGG
CCTTGATCTGCTATTTTTGAAGGAAGGGGGCCTTTGTGCAGCCCTAAAAGAGGAATGCTG
TTTCTATGTTGACCACTCAGGCGCGGTGCGAGACTCCATGAGGAGACTCAAGGAAAGGTT
AGATAAGAGGCAGTTAGAGCACCAAAAGAATTTAAGTTGGTACGAGGGATGGTTCAACCG
TTCCCCCTGGCTTACTACTTTACTGTCTGCCCTTGCTGGTCCCCTGCTACTCCTCCTTCT
GTTACTCACCCTCGGGCCTTGTGTCATCAATAAGTTAGTGCAATTCATCAATGATAGGGT
TAGTGCAGTAAGGATTCTGGTTCTCAGGCACAAGTACCAGACCCTAGACAACGAGGATAA
CCTTTAATTCTGCTCTATGATTAGAGCTACCCTCAAAGAAAATGGGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
trinity assembly of QUT KoRV RNASeq data 2014-03-12
Resources