bonemarrow_either_comp420_c0_seq1 (mRNA) Phascolarctos cinereus

Feature Details
Name bonemarrow_either_comp420_c0_seq1
Unique Name bonemarrow_either_comp420_c0_seq1
Internal ID 1622045
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 2682
Sequence
The sequence for this mRNA
ACATTTTCTGGGTGGGTAGAAGCCTTCCCTACAAAAACAGAGACAGCCCTGACCGTCTGC
AAGAAGATACTTGAGGAAATCCTACCTCGTTTCGGGATCCCTAAGGTACTCGGGTCCGAC
AATGGCCCTGCCTTCGTTGCTCAGGTAAGCCAGGGGTTGGCCACTCAACTGGGGATTAAT
TGGAAATTACATTGTGCATATAGACCCCAGAGCTCAGGTCAGGTAGAAAGGATGAATAGG
ACAATTAAAGAGACCTTGACAAAATTGGCCTTAGAGACCGGTGGAAAAGACTGGGTGACC
CTCCTCCCTTTGGCGCTACTTAGGGCCCGGAATACCCCTGGCCAGTTTGGCCTGACTCCT
TATGAGATTCTTCATGGGGGGCCGCCCCCTGTACTTGCATCTGGGGAAGTCGTGGGTTCT
AATGGTGATTTTTTTCCCGTTCTATTTACCCACTTGAAGGCTTTAGAGGTTGTGAGGACT
CAGATCTGGGACCAGATAAAAGAAGCCTACAGGCCTGGTACTGTGGCCATTCCCCACCCG
TTCCAGGTCGGTGACCGAGTGCTGGTTAGACGTCATCGGTCCGGCAGCCTTGAGCCTCGG
TGGAAAGGCCCATACCTGGTGCTACTGACCACCCCGACCGCGGTGAAGGTTGACGGTATT
GCTGCCTGGGTCCATGCTTCTCATCTCAAACCCGCGCCACCCGGGGCACCCGATGAGTCC
TGGGAACTGGAAAAGACTGATCATCCTCTTAAGTTGCGTGTTCGGCGGCGCCGAAATGAA
TCGACAGCATAACAACCCTCACCAACCCATGACTCTCACCTGGCAGGTACTGTCCCAGAC
GGGAAGTGTCGTTTGGGAAAAGAAAGCAGTCGAGCCACCCTGGACGTGGTGGCCCTCTCT
TGAGCCTGATGTGTGTGCGCTGGTAGCCGGTCTCGAGTCCTGGGACATCCCGGAACTCAC
TGCATCGGCCTCTCAACAGGCCAGGCCCCCTGATTCAAACTATGAACATGCTTATAATCA
GATCACTTGGGGAACCCTGGGATGTAGCTATCCCCGGGCCAGAACAAGAATTGCTAGGTC
CCAGTTCTACGTGTGCCCCCGGGATGGCCGTTCCCTGTCCGAGGCCCGGAGGTGCGGAGG
ACTTGAATCTTTGTACTGTAAAGAGTGGGGTTGTGAGACCGCGGGAACCGCCTACTGGCA
ACCCCGGTCCTCGTGGGACCTTATAACTGTAGGCCGGGGTCACCCTACAGGGACATGCGA
GCACACCGGTTGGTGCAACCCACTCAAGATAGAGTTCACCGAGCCTGGCAAACGATTCCG
AAACTGGCTACAGGGGCGGACTTGGGGTCTAAGGTTCTATGTGACTGGACACCCAGGCGT
GCAGTTGACCATACGACTAGTGATCACAAGTCCCCCACCGGTAGTAGTGGGCCCCGATCC
TGTCCTCGCAGAACAAGGACCTCCCAGAGAAATTCCCTTCCTCCCCAGAGTGCCGGTTCC
TACCCTATCACCCCCAGCGTCCCCTATCCCCACGGTACAGGCTAGCCCCCCGGCCCCTAG
TACTCCATCTCCCACCACGGGCGACCGGCTCTTTGGCCTCGTACAAGGGGCCTTTCTGGC
CTTGAATGCCACCAACCCGGAGGCCACGGAGTCTTGCTGGCTCTGTCTAGCCCTCGCCCC
TCCTTATTACGAAGGAATCGCAACTCCAGGGCAAGTCACTTATGCCTCCACAGATTCCCA
ATGTCGCTGGGGAGGAAAAGGGAAGCTCACCCTCACTGAAGTCTCTGGACTCGGGTTATG
TATAGGGAAAGTACCTCCTACTCACCAACATCTCTGTAACCTGACTATACCCTTAAACGC
CTCACATACTCACAAGTACCTCCTCCCCTCCAACCACAGCTGGTGGGCTTGTAATTCTGG
CCTCACCCCCTGCCTCTCTACATCAGTCTTCAACCAGTCTAACGATTTCTGTATCCAGAT
CCAGCTTGTCCCTCGCATCTACTATCACCCAGACGGTACCTTGCTACAGGCCTATGAGTC
CCCCCACCCTAGACACAAGAGAGAGCCTGTCTCACTCACCCTGGCTGTCCTTCTCGGATT
AGGGGTCGCAGCAGGTATAGGTACCGGCTCGACCGCCCTAATAAAAGGGCCCATAGACCT
CCAACAAGGTTTGACCAGCCTCCAGATTGCCATGGATACAGACCTTAGGGCCCTTCAAGA
CTCCATAAGTAAACTAGAGGATTCCTTAACCTCCCTGTCTGAAGTGGTGCTCCAGAATAG
GAGAGGCCTTGATCTGCTATTTTTGAAGGAAGGGGGCCTTTGTGCAGCCCTAAAAGAGGA
ATGCTGTTTCTATGTTGACCACTCAGGCGCGGTGCGAGACTCCATGAGGAGACTCAAGGA
AAGGTTAGATAAGAGGCAGTTAGAGCACCAAAAGAATTTAAGTTGGTACGAGGGATGGTT
CAACCGTTCCCCCTGGCTTACTACTTTACTGTCTGCCCTTGCTGGTCCCCTGCTACTCCT
CCTTCTGTTACTCACCCTCGGGCCTTGTGTCATCAATAAGTTAGTGCAATTCATCAATGA
TAGGGTTAGTGCAGTAAGGATTCTGGTTCTCAGGCACAAGTACCAGACCCTAGACAACGA
GGATAACCTTTAATTCTGCTCTATGATTAGAGCTACCCTCAA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
trinity assembly of QUT KoRV RNASeq data 2014-03-12
Resources