Locus_10002_Transcript_4/4_Confidence_0.000_Length_390 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10002_Transcript_4/4_Confidence_0.000_Length_390
Unique Name Locus_10002_Transcript_4/4_Confidence_0.000_Length_390
Internal ID 612083
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 390
Properties
Properties for the feature 'Locus_10002_Transcript_4/4_Confidence_0.000_Length_390' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0.003322 adrenal=0
Sequence
The sequence for this mRNA
GTCTTGTTTGTGGAACAGCCAGGAGTTCTTCAGATTTCTCATTTTATCTTTAAGATTCCT
TCTACCTCTAACTTCTGTGTGGAAAATAGAAGGGAAAAAAACCATATATTAAGCACCCAA
GTTAGAAGAGCTCTGCTTTAGCCTTGGCTCCATTCTTCACTTCTCCAATATTTTCATCTT
GGTCACTTTTCTCAAAGTCCCTCTGATGCACCTTTATGGAAGATTTGTAAGTCACATTCT
TTCCCTCCTCTTTGGCAATTTCCTCCATATCCTTGTTGTCAACCTCTTGGCACTCTTATA
ATGATTGGCAAGCTGAGTGAATAGAGTGTAAGGCCTGGAATCAGGAGGATTGGAGTTCAA
ATATAGCCTCAGACATTTGCCAGCTGTGTG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources