Locus_10002_Transcript_2/4_Confidence_0.786_Length_1282 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10002_Transcript_2/4_Confidence_0.786_Length_1282
Unique Name Locus_10002_Transcript_2/4_Confidence_0.786_Length_1282
Internal ID 612081
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1282
Properties
Properties for the feature 'Locus_10002_Transcript_2/4_Confidence_0.786_Length_1282' include:
Property Name Value
Expression spleen=0.260328 liver=0.016985 uterus=0.443527 kidney=0.107668 lung=0.003142 heart=0.235704 brain=1.02714 adrenal=0.128319
Sequence
The sequence for this mRNA
GGGGTGGTCCCTGCCCTCAAGAGGCTTATATTCTAATGGATTTGTTACATGTGTTATGTG
TTATGTGTGTTAATGTACATGTATATAACATAACATAATTACATATTTAACACATGAACA
CAAGGTTAAGGGTTGTGTGTGTTACACAACAATGTATTAACATGTTTATAATATGTTATA
TTACATATTATAACATGTATGCATATGTGTGTATACATACACACACCTATAAACCCGTCA
TTGCCAGATTGTAGAGTGAATGAAAGTAAATAATGAGAGGTTATGGACTATGATTTTGTA
CCACTAGCTGCCTGTGCTGTTGGCTTCCTAGATAGCAGGAGGTGCTCAGAAAATATTTAA
AAATATAATCTTTCTTATCTAATATCTCTCTCAAAATGAAATTGCTGAAAGAATAACATG
CTTAGATTATTTACCCTGATAGGGAAAGAAAGCAGACAAAATAAGATATAATTTTCAACT
GGTATAATGCTGATCAATAAACAGTTATTAAGTGCCTACCATATGCTAGGCAATGTGCCA
AGTACTGGACATACAAAGAAGGTAAAAAAAACAATCCCTGCCCTGAAGGAGTTTACAATC
TAATGAGGGAGATAATGTGCAAACAAAAATATACAAAGCAAGATATATACAGAATAAATG
TAAACTAACAGAAAGAAGGCATTGGAATTAAGAGGGTTTGGGGAAGACTTCCTGTAAGAA
GGTGGGATTTTAATTGGGACTAAATGGAAGCCAGGGAGGTCAGCAGTCAGAGCAGAGTAG
AGAGAGCATTCCAAGGCTGGGGTACAGCCAGACCTGAGATACGGAGTGTCTTGTTTGTGG
AACAGCCAGGAGTTCTTCAGATTTCTCATTTTATCTTTAAGATTCCTTCTACCTCTAACT
TCTGTGTGGAAAATAGAAGGGAAAAAAACCATATATTAAGCACCCAAGTTAGAAGAGCTC
TGCTTTAGCCTTGGCTCCATTCTTCACTTCTCCAATATTTTCATCTTGGTCACTTTTCTC
AAAGTCCCTCTGATGCACCTTTATGGAAGATTTGTAAGTCACATTCTTTCCCTCCTCTTT
GGCAATTTCCTCCATATCCTTGTTGTCAACCTCTTGGCACTCTTATAATGATTGGCAAGC
TGAGTGAATAGAGTGTAAGGCCTGGAATCAGGAGGATTGGAGTTCAAATATAGCCTCAGA
CATTTGCCAGCTGTGTGGCCTTGGGCAAGTCATTTGACCTTATTTGCCTCAGTTTCCTCA
CATATAAAATGAGCTGGAGAAG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources