Locus_100029_Transcript_1/1_Confidence_0.000_Length_311 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100029_Transcript_1/1_Confidence_0.000_Length_311
Unique Name Locus_100029_Transcript_1/1_Confidence_0.000_Length_311
Internal ID 790732
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 311
Properties
Properties for the feature 'Locus_100029_Transcript_1/1_Confidence_0.000_Length_311' include:
Property Name Value
Expression spleen=0.171632 liver=0.340073 uterus=0 kidney=0.194558 lung=0.165521 heart=0.078303 brain=0 adrenal=0
Sequence
The sequence for this mRNA
GTTGGAGGTACTGAGGTTCCAGAATTCAAGAAGGTAGCACCTCAGATGGACATCAGTTAG
GTCAGAGTCCCTTACAACTTGATATAAAGGAGTAGCAGAAAATAAAGCTAGAAATAGAAA
GGTAGATTGGGCGAAATAATTTAAAAAGTCTTAACTTGTAGAATAAGAAGTTTGAATCTA
GTCTTATAGTGGAATGATTGAAAGATTTTCATCAGGAAAGGGATATGATCAAAGCCTTCA
TTTAATTCCTCTGCATTCAGCTTCCAGTTTTCTGTGGGAAGAAGATGACAGCATGTATAA
TTGTATTTGGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources