Locus_100028_Transcript_1/2_Confidence_0.750_Length_459 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100028_Transcript_1/2_Confidence_0.750_Length_459
Unique Name Locus_100028_Transcript_1/2_Confidence_0.750_Length_459
Internal ID 790730
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 459
Properties
Properties for the feature 'Locus_100028_Transcript_1/2_Confidence_0.750_Length_459' include:
Property Name Value
Expression spleen=0.707424 liver=0.01575 uterus=0 kidney=0 lung=0.135639 heart=0 brain=0.079148 adrenal=0
Sequence
The sequence for this mRNA
GGAAGTCCCATGCAAGTTTCTTGCCAGGGGGAGCGTTTCATTTTTCTGCACTTGTAACCC
CAGCACCTAGCACAGTGCCTGACCTGTGTTAAGCATTTAATCAATGCTTGCTGATTGATT
GATTGATTTAGGGCAGAGAGTCCTCTTTTTTCCCCTTTTTTAATCCCCAGGGCCTTTCAC
ATGGTAGGCACTTAGTAAATCCTGCTTGAATTGAATTGATTGGCTCCACTTCTGGTCTCT
GGTTATGCATTTCAGCCTAATCTCTTTTTCCCTCTTGACTGAGCACTAGCTTTTACTGAA
TCCCAACTTCTACTCAATGAATTCTTCCCTTTCACTAACTGTAACTTACACCCCAGGAGT
GAGACTTGGGGCATACATGGAGTCTGCCATGCTAGAATCCCTGATGGTCTCACAGCAGTG
GTTCTCTGGTCTAATCACCAGGCAATTGGGCAGCCTCAG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources