Locus_100027_Transcript_1/1_Confidence_0.000_Length_315 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100027_Transcript_1/1_Confidence_0.000_Length_315
Unique Name Locus_100027_Transcript_1/1_Confidence_0.000_Length_315
Internal ID 790729
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 315
Properties
Properties for the feature 'Locus_100027_Transcript_1/1_Confidence_0.000_Length_315' include:
Property Name Value
Expression spleen=0.754256 liver=0.140837 uterus=0 kidney=0 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
CCCCCCCAAAGTGGTGGTAGTTCTATTTTGCTTTATATTAGTGTCTTACTTTCTATCTTC
AGCTGACTTGGGGTAAATGTCTAGTGGTAGGATTATTGGATTATGTCAGTACAATTCCAT
CCAGTAAGTATTAAATCCCTATCACATGCAAGGCACTGGAGTCAGTCAACGAACATTTAT
TAGACACCTACTCTATTCCAGGCGCTATGCTAAGCACTCAGGAAACAAAGAAAGGCAAAA
GGCAACAGCTGCTCTCTAGTTCATGTCTAATCCCAGAAGGCACTGGGGATCCAGAGACAG
AAAAATTCAGTAGTC
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources