Locus_100026_Transcript_1/1_Confidence_0.000_Length_280 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100026_Transcript_1/1_Confidence_0.000_Length_280
Unique Name Locus_100026_Transcript_1/1_Confidence_0.000_Length_280
Internal ID 790728
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 280
Properties
Properties for the feature 'Locus_100026_Transcript_1/1_Confidence_0.000_Length_280' include:
Property Name Value
Expression spleen=0.82 liver=0 uterus=0 kidney=0 lung=1.04537 heart=0.094208 brain=0 adrenal=0.431919
Sequence
The sequence for this mRNA
GTCATCTCCCTGATGTCGTGGTCCTGTTTGAGAATGAAGTACAAACAGCAGCCTGCTAGT
ACCTTCCTATTCCTCTTCCCCATGATCTCTTGTTCATTTTTTACATCAGATGTATACATG
TTGTTTACCCTGATAGAACATAAGCTTTTTTATGGCTGGGACTAATTTTGCTTTTGACTG
TGTACCCCCAGCATCTAGTACAGTATCTGGAACATAGTAGGTACTTAATAATGCTTGTGG
ATCATTATAGAGTGATATTTGTCCTGTCTCCTAACATCAG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources