Locus_100025_Transcript_1/1_Confidence_0.000_Length_187 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100025_Transcript_1/1_Confidence_0.000_Length_187
Unique Name Locus_100025_Transcript_1/1_Confidence_0.000_Length_187
Internal ID 790727
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 187
Properties
Properties for the feature 'Locus_100025_Transcript_1/1_Confidence_0.000_Length_187' include:
Property Name Value
Expression spleen=1.24779 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
TGCAATCTCATAGCTTCAATTGTCCCCTCTATCTAGATAACCAGTAAATCTGGGTCTCCA
GCCATAGCCTCTTACCAAGTTTCCAGTCCCATTTATCCACGGCCTCCAAAGAGGCCCTGG
TCACACGCACTGCCCTCAGAATGGCCCTCAAAGAAAGGCCCGTGGCCCTGCCAGGGATCC
CCTCACG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources