Locus_100024_Transcript_3/3_Confidence_0.000_Length_859 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100024_Transcript_3/3_Confidence_0.000_Length_859
Unique Name Locus_100024_Transcript_3/3_Confidence_0.000_Length_859
Internal ID 790726
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 859
Properties
Properties for the feature 'Locus_100024_Transcript_3/3_Confidence_0.000_Length_859' include:
Property Name Value
Expression spleen=0 liver=0.211483 uterus=0 kidney=0.346474 lung=0 heart=0.004072 brain=0.032085 adrenal=0
Sequence
The sequence for this mRNA
AGACATCACCCTCCTGATATCACTGGGCCTCTTCAAGAATGAAGGACTGACAACCTTAGA
CCATCAACTCTGAGGACTGGAGATAAGTTAAAGCCTAAAGGTCAACAGAGATCAAGACAG
GGTTACACAGGTCAAGAAAGGAGTGGCCTAGGACCACAGAGATTAAAAAAAAAGTTAATA
TTTGAAAAGCATTTTCAAAACTCAAAGCACTAGATAAATGCCAGCTAGTCTAGAAAAGAG
GTATTATATAATTTATAACTAGAAGAGATTGTAAAGTTCATCTGGCCCAACACTTTCATT
CTATATGTAACAGAGGACTGGGCTGTCACTGGTCAATCTCAGGCCTGCATTAGGTACAGT
TGAGGAAACTGAGGTCCAGATGTCAAGTCAAGTGACTTGACTTGCCCAAGGCTACCCAGA
TTCTGAGCCAAAATTTGAACATATACTTCCTAGTTCTCCATCCAGTATGCTTCCTAACAA
ATCAGGCTGGTTCTGCACCCAGGTGGTCAGCACAAGTAGAAGGAGGGATCTGGTTGGGAG
ACTCAAGGCCAATTTGAGTCCGGAAGGCTGAGTTTTTTGGACATGGTTCTGACAAATAAA
ATGCACTTAAGGAAATTTGATCCCAGGGAAGGGGGCCCTTTCTTCTCTTCTGTACTTCCC
AACCCTGTCATTTCTGGCTCTGTATCTGTCTCTGTGAGGAATGTACCTGCCCTTGTAATG
AAAGCTTCTGCTAGAGAGATCAAATGTAAAGGGGAAGAGGTTGGACAGTACTGAGCTTAA
AGGACAGATGTGGATTAATTTCAGATTCAGCTGTTGGGATGTGATCACATTGTTGATTGT
TCAAAATCAAATAGGCCCG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources