Locus_100024_Transcript_2/3_Confidence_0.333_Length_1164 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100024_Transcript_2/3_Confidence_0.333_Length_1164
Unique Name Locus_100024_Transcript_2/3_Confidence_0.333_Length_1164
Internal ID 790725
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1164
Properties
Properties for the feature 'Locus_100024_Transcript_2/3_Confidence_0.333_Length_1164' include:
Property Name Value
Expression spleen=0.010078 liver=0.002146 uterus=0 kidney=0.318909 lung=0 heart=0.013315 brain=0.014622 adrenal=0
Sequence
The sequence for this mRNA
CCCAAGTATTTTGTAGTTATTTTCAGTGGAATTTCTCTATCTCCTCCTGCTAGGTTTTAT
TAGTAATATACAGACATATTCATGGCTTGTGTGGATTTCTTTTATATCCTATAATTTTGC
TGAAAACGAGACCTGGGAAAAATCTTAGCTAAAACAGGCCAAGGCTTCCCACTACATCCG
GGTCCATCACACCAGTCGTGCAGACCTATCTCTTGCCACTGGACTCCCACGACCCTGGAG
GAGAGAGTGGGGCTAATGACTTTGCAACAGCTCTGCCTCACTCAAATTCAATTCACTTGA
AGTTAAGACATCACCCTCCTGATATCACTGGGCCTCTTCAAGAATGAAGGACTGACAACC
TTAGACCATCAACTCTGAGGACTGGAGATAAGTTAAAGCCTAAAGGTCAACAGAGATCAA
GACAGGGTTACACAGGTCAAGAAAGGAGTGGCCTAGGACCACAGAGATTAAAAAAAAAGT
TAATATTTGAAAAGCATTTTCAAAACTCAAAGCACTAGATAAATGCCAGCTAGTCTAGAA
AAGAGGTATTATATAATTTATAACTAGAAGAGATTGTAAAGTTCATCTGGCCCAACACTT
TCATTCTATATGTAACAGAGGACTGGGCTGTCACTGGTCAATCTCAGGCCTGCATTAGGT
ACAGTTGAGGAAACTGAGGTCCAGATGTCAAGTCAAGTGACTTGACTTGCCCAAGGCTAC
CCAGATTCTGAGCCAAAATTTGAACATATACTTCCTAGTTCTCCATCCAGTATGCTTCCT
AACAAATCAGGCTGGTTCTGCACCCAGGTGGTCAGCACAAGTAGAAGGAGGGATCTGGTT
GGGAGACTCAAGGCCAATTTGAGTCCGGAAGGCTGAGTTTTTTGGACATGGTTCTGACAA
ATAAAATGCACTTAAGGAAATTTGATCCCAGGGAAGGGGGCCCTTTCTTCTCTTCTGTAC
TTCCCAACCCTGTCATTTCTGGCTCTGTATCTGTCTCTGTGAGGAATGTACCTGCCCTTG
TAATGAAAGCTTCTGCTAGAGAGATCAAATGTAAAGGGGAAGAGGTTGGACAGTACTGAG
CTTAAAGGACAGATGTGGATTAATTTCAGATTCAGCTGTTGGGATGTGATCACATTGTTG
ATTGTTCAAAATCAAATAGGCCCG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources