Locus_100024_Transcript_1/3_Confidence_0.667_Length_362 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100024_Transcript_1/3_Confidence_0.667_Length_362
Unique Name Locus_100024_Transcript_1/3_Confidence_0.667_Length_362
Internal ID 790724
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 362
Properties
Properties for the feature 'Locus_100024_Transcript_1/3_Confidence_0.667_Length_362' include:
Property Name Value
Expression spleen=0.049748 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0 adrenal=1.12101
Sequence
The sequence for this mRNA
CCCAAGTATTTTGTAGTTATTTTCAGTGGAATTTCTCTATCTCCTCCTGCTAGGTTTTAT
TAGTAATATACAGACATATTCATGGCTTGTGTGGATTTCTTTTATATCCTATAATTTTGC
TGAAAACGAGACCTGGGAAAAATCTTAGCTAAAACAGGCCAAGGCTTCCCACTACATCCG
GGTCCATCACACCAGTCGTGCAGACCTATCTCTTGCCACTGGACTCCCACGACCCTGGAG
GAGAGAGTGGGGCTAATGACTTTGCAACAGCTCTGCCTCACTCAAATTCAATTCACTTGA
AGTTAAGACATCACCCTCCTGATATCACTGGTCCTCTTTTGCTTCAAGGCCACAGAGCCG
AG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources