Locus_100023_Transcript_1/1_Confidence_0.000_Length_321 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100023_Transcript_1/1_Confidence_0.000_Length_321
Unique Name Locus_100023_Transcript_1/1_Confidence_0.000_Length_321
Internal ID 790723
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 321
Properties
Properties for the feature 'Locus_100023_Transcript_1/1_Confidence_0.000_Length_321' include:
Property Name Value
Expression spleen=0.359894 liver=0 uterus=0 kidney=0 lung=0.610069 heart=0 brain=0.117748 adrenal=0
Sequence
The sequence for this mRNA
CTGTAAGTTTACATAAACTCATAGCTGAAACCTACTTTTGCCTCTTACATCTGAATCCTA
AGATCTCAGGTTGGAGCAGCTTTACAAGGAGGCTAGTCTGGCCCATTAGTTGAAAAGTAC
TCCCTGCTGTGATGTGCCAAGCGAGGGGTCCCCTCGCCTCTGCTCGAAGATCTTGAGTGA
GAGGGAATCCACTGCCTCCTGAGGCAGTCCATCCACCTGTAGACTTTGGGGAATTCTTCT
CCCATGTCAAGCTAAGTTTGTCTCTCGGCCACTTTCAGCTGTTGCTCCTACTTCTATCTG
CTGGGGCCAGGCAGAGCCGGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources