Locus_100021_Transcript_1/1_Confidence_0.000_Length_279 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100021_Transcript_1/1_Confidence_0.000_Length_279
Unique Name Locus_100021_Transcript_1/1_Confidence_0.000_Length_279
Internal ID 790720
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 279
Properties
Properties for the feature 'Locus_100021_Transcript_1/1_Confidence_0.000_Length_279' include:
Property Name Value
Expression spleen=0.549832 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0.352113 adrenal=0.389365
Sequence
The sequence for this mRNA
ATCGGTCTGCAGCTCTTTGCTATCGAATGGTTTTATCAATGACTTGGATGAAGTCATAGG
TGATATGCTGACATGTCTGAGTTGTCCTGTCATCCTCGGACCCTAATGTTTAGGTTCACA
AGCAAATGGAACCCTTATTTTCCAGCAGTCTCTAGATCACTTGATCTCTGCAAATCATGA
TGCTAATTTTTTAAATGACCATGCACTGCAAAGAGGTTCCATTTCTCATTCTGTCCCTCT
AAAGCTGCCTCCTATAGTACATACTTTGTGACATGTCTG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources