Locus_100020_Transcript_1/1_Confidence_0.000_Length_425 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100020_Transcript_1/1_Confidence_0.000_Length_425
Unique Name Locus_100020_Transcript_1/1_Confidence_0.000_Length_425
Internal ID 790719
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 425
Properties
Properties for the feature 'Locus_100020_Transcript_1/1_Confidence_0.000_Length_425' include:
Property Name Value
Expression spleen=0.955562 liver=0 uterus=0 kidney=0.291513 lung=0 heart=0.057951 brain=0 adrenal=0.339422
Sequence
The sequence for this mRNA
GGATGGATTGGAGTGAGGAGACTTGAAGCAGGCCAATTCACCAGCTGTCTATTGCAAGAA
TCAAGCTATGAGGTGATGAGGGCCTGCACTAACAGTATCAGTGTCAAAGGAGAGAAGGGA
AGGCCATATTCAGATGTTGCAAAGGTTGAGTGTGGTGAGTATAATTGGCAGGCCCCAGCA
ATACCTTGGATATTGGGGAAGAAAGAGGGGTGAGAGGTAGTGAGGAATTCAGGATGACTC
CTAGGCTGACAGCCTGAAGGGTGGGAGGATGGTGTTGCCCTCCACAGTAATTGGGAAAAG
AAGGGGCAAGGAGAACTATATAGCCTAACTCCTTCACGTCTATTTTAAACAATGAGTAAA
AAGAAATGGAGTCTTTAAATTAAAAGGCAACAAAATTAATATTTCACCAGAATTTTTTTT
TTTAA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources