Locus_10001_Transcript_9/14_Confidence_0.025_Length_549 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_9/14_Confidence_0.025_Length_549
Unique Name Locus_10001_Transcript_9/14_Confidence_0.025_Length_549
Internal ID 36
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 549
Properties
Properties for the feature 'Locus_10001_Transcript_9/14_Confidence_0.025_Length_549' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
TAACAACGGGATTAAATACTACATCTCACTTCATGTGCCACAATTTTATTTAAAAAGCAT
AAAAAGAATTAGACACAAGCAGCTTTTATCACCATGGTGGAGGTTTGCCATATTTATATC
TAATAAACAAAAGGAAGGAACTACAAAAGAGCAAATAAAGGAGTTTAATTATAGAAAGAG
CTTTTGCACAACAAAAAGCAATGCTTCCAAAATAAAAAAGAAAGCACAGTGGGAGGGGAA
GTTTTCTACATATGCTTCTTTCCATATATGCTTTCCTCCTAAAAGGAGAAAAAGTCCAAA
AATATTCTTAGCAGCAACATTTATAGTAGCAAAAACTTGAAAACAAGTGGAAACAAATGA
ATGGCTAAACAAAAGAGAGAAGAAAAATGAGAGTAGAGTGGAATATTATTACACAATCAT
TTAGTTCATTTTGTGAAGCACCTGCCCCGGGCCAGGAAGCATACCAGGTGCTGGGAGATG
TAAAGACAACAGGAAATGGGCCCTCCCTAAAGGAGCATGGGTAAGAAATGACAGAAATGA
AGGAACCAG
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.332463 polypeptide m.332463:2..340 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources