Locus_10001_Transcript_7/14_Confidence_0.543_Length_1398 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_7/14_Confidence_0.543_Length_1398
Unique Name Locus_10001_Transcript_7/14_Confidence_0.543_Length_1398
Internal ID 612079
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1398
Properties
Properties for the feature 'Locus_10001_Transcript_7/14_Confidence_0.543_Length_1398' include:
Property Name Value
Expression spleen=0.065915 liver=0.002205 uterus=0.12508 kidney=0.0331 lung=0.283591 heart=0.052665 brain=0.006574 adrenal=0.089405
Sequence
The sequence for this mRNA
ATTATTATATTAATACATTAGTAATTATATAATATTACTTAAAGTAATTAAGTATGGGTA
CTTGTTTTTGTGAATGGTACTAAATTCTGAAAGAAATTTTTTAACTTTAAAAACTAAATA
AAAAGGAATGACTTTTCATCTGAGACTAAGAAATATGGGGAGGTAGGGGAACAGAGAGGT
CAGGAAACCAACTTAGTGAATTGGAAGGAAAGAGTCTATGAGCCAGCTCAGGCTAGCTAG
TCTGAAAAGTGATTTCTAAGAAAAGTAGTCTTCTGAGAGCTAAGAGTAGTCTGCTAAGAG
CTGACATAAGTAGTTCCATTTTGCTGTGGATTTGCCACTTTTGCTATGTATGACCCCTGC
ATGAACTCAGGACCAGCTCACCACAGCTGGTTCCCATTAGCATCTCCTTTCCTCCTCTAA
CTGGTGCAAAAGACTTACTCATTACAAATGTGGACTGCCCCGCCCCAAGACTCACACCTT
CCCTATTCTCTTGTCTCACAAATGATGGCGGTCCCCCTTGATCTGAGGTTAACTAAGGAT
ACTAACAAGGACATGGTGCTTCTCTAGCTCTTGCAGCTAATTAGCTAATTCACCTTCACA
AGCCGACCTCTTTTCTTTGTGTAATCAGTTGCATTATAACAAGCAGTCTGTTTTTTTTCT
TTTTGTCTCTTACAATCCATTCGGATTCTAAGAGATACATTTCCCTCAACTGCTGGCAGA
AAGGGTCTCACCCCAAGGGAATCAAAACTGCAGTGTCCCTGTCTCTGGCTCGTGCTGGCT
TACTGGGAGTTGCCAGTTAAGTGGTCTAAAAGAGAGTCCACACAACACTAGGCCCAGATT
TTCCCCCAGACCCCTCTGTGAGGAGAGCTCCCTGCCCAGCATTTCCAAGGTGCAGCCACC
TGACCAAGCCAGCTGAGCTCTTGTCTACCATGTCTGTCTGTCACTCACTCACCTGGACAA
ATGCCTCTTGAGACTCCATCCTCTGGCATCCAGGACACTCGACCTCTCTCCAGCTCGGAG
ACAATATCTGGTTTGGAAACCGGAAGCCCCAAAGAGACCAGGTTCTCATAGTTCTCCAGC
ATCACCTCCCTGTACGGGCCCTCTGAGCAGGGCCCAGGTGCCCCACTCCTCCCAGGAGAA
GTCCACGGCCACATCCTTGAATGTCACTGACTCCTGAAAGCTGGTGGGCAGGGACCCAGA
AATCATCCCTTCCTCCTCCGTCTCCTCAATGCTTTTGTCTCATAAAGGGCAGAGTCTTGG
AAAGGCAGAACTGTGCGTGGCCAAACTGGCCCACGAACAAAGAGCGGACCCGACCGACCC
CACGAGGAACTGCGCCTGCGCACCGTGAGCCTTCGAACTACGACTCCCAGAAAGCGTCGA
GCTCCGCGGCAGTCCCGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources