Locus_10001_Transcript_6/14_Confidence_0.012_Length_978 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_6/14_Confidence_0.012_Length_978
Unique Name Locus_10001_Transcript_6/14_Confidence_0.012_Length_978
Internal ID 612078
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 978
Properties
Properties for the feature 'Locus_10001_Transcript_6/14_Confidence_0.012_Length_978' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0.000037 brain=0 adrenal=0
Sequence
The sequence for this mRNA
ATTATTATATTAATACATTAGTAATTATATAATATTACTTAAAGTAATTAAGTATGGGTA
CTTGTTTTTGTGAATGGTACTAAATTCTGAAAGAAATTTTTTAACTTTAAAAACTAAATA
AAAAGGAATGACTTTTCATCTGAGACTAAGAAATATGGGGAGGTAGGGGAACAGAGAGGT
CAGGAAACCAACTTAGTGAATTGGAAGGAAAGAGTCTATGAGCCAGCTCAGGCTAGCTAG
TCTGAAAAGTGATTTCTAAGAAAAGTAGTCTTCTGAGAGCTAAGAGTAGTCTGCTAAGAG
CTGACATAAGTAGTTCCATTTTGCTGTGGATTTGCCACTTTTGCTATGTATGACCCCTGC
ATGAACTCAGGACCAGCTCACCACAGCTGGTTCCCATTAGCATCTCCTTTCCTCCTCTAA
CTGGTGCAAAAGACTTACTCATTACAAATGTGGACTGCCCCGCCCCAAGACTCACACCTT
CCCTATTCTCTTGTCTCACAAATGATGGCGGTCCCCCTTGATCTGAGGTTAACTAAGGAT
ACTAACAAGGACATGGTGCTTCTCTAGCTCTTGCAGCTAATTAGCTAATTCACCTTCACA
AGCCGACCTCTTTTCTTTGTGTAATCAGTTGCATTATAACAAGCAGTCTGTTTTTTTTCT
TTTTGTCTCTTACAATCCATTCGGATTCTAAGAGATACATTTCCCTCAACTGCTGGCAGA
AAGGGTCTCACCCCAAGGGAATCAAAACTGCAGTGTCCCTGTCTCTGGCTCGTGCTGGCT
TACTGGGAGTTGCCAGTTAAGTGGTCTAAAAGAGAGTCCACACAACACTAGGCCCAGATT
TTCCCCCAGACCCCTCTGTGAGGAGAGCTCCCTGCCCAGCATTTCCAAGGTGCAGCCACC
TGACCAAGCCAGCTGAGCTCTTGTCTACCATGTCTGTCTGTCACTCACTCACCTGGACAA
ATGCCTCTTGAGACTCCA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources