Locus_10001_Transcript_4/14_Confidence_0.049_Length_1316 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_4/14_Confidence_0.049_Length_1316
Unique Name Locus_10001_Transcript_4/14_Confidence_0.049_Length_1316
Internal ID 30
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1316
Properties
Properties for the feature 'Locus_10001_Transcript_4/14_Confidence_0.049_Length_1316' include:
Property Name Value
Expression spleen=0.085231 liver=0.002282 uterus=0.165378 kidney=0.137586 lung=0.013511 heart=0.084129 brain=0.2604 adrenal=0.123631
Sequence
The sequence for this mRNA
CAGAGAGTCCTGCCAACATTAAACATGGAGATAATGTCCCAGGATTCCATCAGTGGCTAC
TGCTACTGGAAAGGTCTCCAGGAATATCCACAAAGGATTCAGATTAGGAAAGAAAAGAGG
ATGACAGTCCGTCATTCCCTAGTCTACATGGGTCCCGTAGAGGAGAGCGTCTGTGCCACT
TTATCGTCATTCACTTGCGTCCAACTCTGTGATCCCATGGAAGCTGTCCATGGTGTTTTC
TTGGCAAAGATTTGGGAGTGGTTTGCTATTTACTTCTCTAACATGTTCCCATCTTACAGA
TGAGGAATTGAGGCAAGTAGGGGGTACCTGACTTGCCCAAGGTCACAAAGCCAGAAACTG
AATAGACTGGACTTGAACTCCAATCTTCCTGACTCCAGGCCCACTGCCCCATCCGTTGCA
CCACCTAGCTGCTCTCTTGTACCTGCTGTATAAAGACTGATAGGTGCCGTTGAAGCTGAG
GTGGATCAGTGGGTGGGGGCCATCCCCACACTTTGACTCTGTAAGCACTTACTGAGGGCC
TACTGTGTGCCGCGTGATCCCAGGGCTGCAGACGCGTGGTACCTCCTCCATCATCCGCGG
TAGCGATCCTTCCCAGCTGGATGCCAGCTCACAACTTGAGGAGCCTTTGTCAAAGGTGGG
GTCACTCGCAACTTTCCCTAGGTCTCTGGTCCTCACCCCACATCCCTCGGACGCAGCTCC
TCCTTTTCCTGCTCTGCTTGCACAGGCTGGTCACCACTCAAGTGTCCGGCCCTCCTCTGG
ACCAGACACCTGGCAGGCTCAGGGTTGCCCCTTTGGTCACACGAGGTCCCTGCATCACGT
GAGGGCCCGGAGCCCCTGAGTCCAGAAATGGCTGGGATGGGGGAAGCGAAAGGGAATAAG
CATTTATGTTGCACCTACTGTGTGCCACCCACAGGGTTAGGCGCTTTACAACTGTGATGG
CATCTGATTCTCAACAACCACCTGGGGAGGTCGGTGCTGTTGTGATTCCCATTTCATAGA
CGGGAAAACGCGACAGACTTAGGTGAAGGGGCTTGCCCAGGGTCTGCATTTGAACCCAGG
TCTTCCTGACGTGCAGCGCTCGGCCCGGCCCCCCGGCCAACAGCAGTGGAGATCTTCCTA
AAAGATCTCCTTTTAGGAAAGGGCTCGATAGAAACTGTCAATCCGGGGGACAGACGGGCC
CTCAGGCTGTCACCCCTCCAAGGCCAAGGCCAAAGCTGGGGGCGGGGTAGTACAGGGTCG
CCCTAGACCGAGGTGGGTCAAGCAGACGCAACGCTCCGCGCAGTGGCCCCGCCTCC
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.332460 polypeptide m.332460:1..303 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources