Locus_10001_Transcript_3/14_Confidence_0.062_Length_901 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_3/14_Confidence_0.062_Length_901
Unique Name Locus_10001_Transcript_3/14_Confidence_0.062_Length_901
Internal ID 612077
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 901
Properties
Properties for the feature 'Locus_10001_Transcript_3/14_Confidence_0.062_Length_901' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
TCCTTGAATGTCACTGACTCCTGAAAGCTGGTGGGCAGGGACCCAGAAATCATCCCTTCC
TCCTCCGTCTCCTCAATGCTTTTGTCTCATAAAGGGCAGAGTCTTGGAAAGGCAGAATGA
GGGCCTACTGTGTGCCGCGTGATCCCAGGGCTGCAGACGCGTGGTACCTCCTCCATCATC
CGCGGTAGCGATCCTTCCCAGCTGGATGCCAGCTCACAACTTGAGGAGCCTTTGTCAAAG
GTGGGGTCACTCGCAACTTTCCCTAGGTCTCTGGTCCTCACCCCACATCCCTCGGACGCA
GCTCCTCCTTTTCCTGCTCTGCTTGCACAGGCTGGTCACCACTCAAGTGTCCGGCCCTCC
TCTGGACCAGACACCTGGCAGGCTCAGGGTTGCCCCTTTGGTCACACGAGGTCCCTGCAT
CACGTGAGGGCCCGGAGCCCCTGAGTCCAGAAATGGCTGGGATGGGGGAAGCGAAAGGGA
ATAAGCATTTATGTTGCACCTACTGTGTGCCACCCACAGGGTTAGGCGCTTTACAACTGT
GATGGCATCTGATTCTCAACAACCACCTGGGGAGGTCGGTGCTGTTGTGATTCCCATTTC
ATAGACGGGAAAACGCGACAGACTTAGGTGAAGGGGCTTGCCCAGGGTCTGCATTTGAAC
CCAGGTCTTCCTGACGTGCAGCGCTCGGCCCGGCCCCCCGGCCAACAGCAGTGGAGATCT
TCCTAAAAGATCTCCTTTTAGGAAAGGGCTCGATAGAAACTGTCAATCCGGGGGACAGAC
GGGCCCTCAGGCTGTCACCCCTCCAAGGCCAAGGCCAAAGCTGGGGGCGGGGTAGTACAG
GGTCGCCCTAGACCGAGGTGGGTCAAGCAGACGCAACGCTCCGCGCAGTGGCCCCGCCTC
C
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources