Locus_10001_Transcript_2/14_Confidence_0.037_Length_784 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_2/14_Confidence_0.037_Length_784
Unique Name Locus_10001_Transcript_2/14_Confidence_0.037_Length_784
Internal ID 612076
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 784
Properties
Properties for the feature 'Locus_10001_Transcript_2/14_Confidence_0.037_Length_784' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
TGAGGGCCTACTGTGTGCCGCGTGATCCCAGGGCTGCAGACGCGTGGTACCTCCTCCATC
ATCCGCGGTAGCGATCCTTCCCAGCTGGATGCCAGCTCACAACTTGAGGAGCCTTTGTCA
AAGGTGGGGTCACTCGCAACTTTCCCTAGGTCTCTGGTCCTCACCCCACATCCCTCGGAC
GCAGCTCCTCCTTTTCCTGCTCTGCTTGCACAGGCTGGTCACCACTCAAGTGTCCGGCCC
TCCTCTGGACCAGACACCTGGCAGGCTCAGGGTTGCCCCTTTGGTCACACGAGGTCCCTG
CATCACGTGAGGGCCCGGAGCCCCTGAGTCCAGAAATGGCTGGGATGGGGGAAGCGAAAG
GGAATAAGCATTTATGTTGCACCTACTGTGTGCCACCCACAGGGTTAGGCGCTTTACAAC
TGTGATGGCATCTGATTCTCAACAACCACCTGGGGAGGTCGGTGCTGTTGTGATTCCCAT
TTCATAGACGGGAAAACGCGACAGACTTAGGTGAAGGGGCTTGCCCAGGGTCTGCATTTG
AACCCAGGTCTTCCTGACGTGCAGCGCTCGGCCCGGCCCCCCGGCCAACAGCAGTGGAGA
TCTTCCTAAAAGATCTCCTTTTAGGAAAGGGCTCGATAGAAACTGTCAATCCGGGGGACA
GACGGGCCCTCAGGCTGTCACCCCTCCAAGGCCAAGGCCAAAGCTGGGGGCGGGGTAGTA
CAGGGTCGCCCTAGACCGAGGTGGGTCAAGCAGACGCAACGCTCCGCGCAGTGGCCCCGC
CTCC
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources