Locus_10001_Transcript_14/14_Confidence_0.235_Length_2256 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_14/14_Confidence_0.235_Length_2256
Unique Name Locus_10001_Transcript_14/14_Confidence_0.235_Length_2256
Internal ID 28
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 2256
Properties
Properties for the feature 'Locus_10001_Transcript_14/14_Confidence_0.235_Length_2256' include:
Property Name Value
Expression spleen=0.00003 liver=0.059892 uterus=0.001202 kidney=0 lung=0.209016 heart=0 brain=0.025533 adrenal=0
Sequence
The sequence for this mRNA
TTTCCAGCACTGATGTCATTACATTGCTTCTCCTCCAGTAGGGTATGAATTCTCTGGTGT
TCTATCAGGCTTCCCCAGCGACTGAAGGCTTTACCACATGCATTACATTTGTGGGGCTTC
TCTCCAGTATGAATGCTCTGGTGCTGAGTAAGATATGACCTTCTGCTGAAGGTTTTGTCA
CATTCATTACATTCGTACAGCTTTTCTCCAGTATGGAGTCTACGAAACTGAATGAGGTCT
GAATGGTAACTGAAGGACTTCCTGCACTTATTGTATTTGTAAAGCTTACTCCCTATGGAG
ATCCTATTACGCTTAATTAGGTCTGAAAAGGGTTTGATGTTCTTCCCCGGTGTATCATAT
TTATGGAGGCTTTTTCCTGTAGGAACTTTTGGCTGTAAAACAAAGATCGATCCCACGCTA
AAACTTCTTCCAAATGTATTGTATTCGGGGACACTCACCTTATTCAAAGCTCGTCTGTGA
GTGACTGTTACTTGTCTGAACTGTTTCTCCTGTTTAGCCTTCTGTCTCTGTAACCTGACA
TTCCACTCCCCAGCTTTTCCTATCTTGGAATACAAAGGGCCATCCTTTGGTGGGCTTTGC
TGTAATGGAGCTCCCATGGTAAGGCCACAGTTTGGAGGTGAACCCTGGATTTCATGCTTA
GCATAATGACTAAGGGAATCTGAAAGAAATCAGAAAAAGAGAACTATTAGTAGCCACTAA
TCTCTGTGAGGGAGGACACAAACTGCTTTAGGTCTGGACTTCTGGGCCTTCCAGAAAGGA
AAAAGATCCTCATTTTGGGAAAGGTAAAACAAACTCTGTTAAGAGGGAACTGAAGCCCAA
GATAGTCCAGGAGACAGCAGCATACTACCGATGCCAAGATCTGAATTAATGATGTTCCAG
GACACTGAAACCACTTACAGATGTCATTAAAACACAAGAGATTCAGTATAAAACCCAGCT
ATTTTCTTGGCAGACAAAAGGGTGGACAGAATGGAAACAGCAGAAAAATGAACTCAGATA
ATACTCAGTTGGAAAATAACTTTTAAGCTCTGCAGACAAAAGTGAGCAATCTGGAAAACA
GAGCAAGGGAAGAAAGTTTCAGAATTATTGGATTTCCCCAAAACAGTAAAGGGAAGATGA
AGAGACAATGTGGTACGGTGGAAAGACAGCCAGGGTTGGAGTCAGGGGGCCTGGATCGAA
GCCCAGTCCTGCTACTTCGTACCAGCAGGATGTTAAGCAAATCCCTTAACCTCCCTGGGA
TTCATCTCTAAAATAAAGATGTCGGGCTGAATGATCTCCCAGATCTCTCCTCCTCCAAAT
CCCCTCATACTGTCATCCTACAGATCTGATTGATGTATCTCAGGAGTCATAAAGGAAAAA
TATCCCAACATACACAATCAGGAAGAGATCACAAATCAACAGAAGAGAATGCCCAAAAGG
ACTGAAGCACTCATTCAACTTGGACAGACACACAATCCTCATGGATTTCTACAAGGGTGA
CATGACAGAGGGAAAAAACAATAAGAAATGACAGAAGTTGGGACAGAGCCCGAGCTAAGC
CACCCAGGACTTCATTTCCAAATCAGCTTCCCTGCAAAGCTTCTCATCCTGTCAAAAGGC
AAGACATAGTCATTTAAAAGGCCCCGTGAATTTGAGAAATTTGTGGTAGAAAAGACTAAA
CTTAAAACGTGAGGCATTGGGCAGAAGGGGGATCACTGTCCAATTAAACTCCTTTTTATC
AACGACTCAGACAAAATGGGCCAAGCCAATCAAATATGCAAACAACAGAAAGCTGGGACA
GCAAGCTCACCCATCAGATTACAGGATTCACAAAGTTCTCAGGAGGCTGTAATGAGGGGG
TGAAGCAGCAGGGGATAGTGGGAAGAACCCTGGACCAACAGCTCCTAGGGGTTCTTCACC
TCTTTGGTGTCCTGGAGCCCTCTGCAACTAGTACAGCAAACCCGTCTCTAGATCTACATT
CATGACTGAAGGAAATGCCAATAAAGAGGGTCCCTCATCTACCACCCCCAACACCCCTGG
AATAACACGGTCTCCACATTGAAAAGGTTTGGGATTACTTTGTATTTACTTATCTCTATA
CACGTTGTTGCTGCCGCCACCACCCTACTCAGTAAACAGAAGGCTCCTGGAGGACAGAAA
TTGTTTCATTTTTGCCTTTTTACTCCCTGTGTCTATTAGGGTTACATTGCAGGCATTACC
AAATGCTTACTGAATCATGTGGCTTCTTCCACCCTT
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.332469 polypeptide m.332469:3..617 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources