Locus_10001_Transcript_13/14_Confidence_0.802_Length_1781 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_13/14_Confidence_0.802_Length_1781
Unique Name Locus_10001_Transcript_13/14_Confidence_0.802_Length_1781
Internal ID 26
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1781
Properties
Properties for the feature 'Locus_10001_Transcript_13/14_Confidence_0.802_Length_1781' include:
Property Name Value
Expression spleen=0.549845 liver=0.187814 uterus=0.688418 kidney=0.828677 lung=0.855565 heart=0.657196 brain=1.15992 adrenal=0.904198
Sequence
The sequence for this mRNA
TTTCCAGCACTGATGTCATTACATTGCTTCTCCTCCAGTAGGGTATGAATTCTCTGGTGT
TCTATCAGGCTTCCCCAGCGACTGAAGGCTTTACCACATGCATTACATTTGTGGGGCTTC
TCTCCAGTATGAATGCTCTGGTGCTGAGTAAGATATGACCTTCTGCTGAAGGTTTTGTCA
CATTCATTACATTCGTACAGCTTTTCTCCAGTATGGAGTCTACGAAACTGAATGAGGTCT
GAATGGTAACTGAAGGACTTCCTGCACTTATTGTATTTGTAAAGCTTACTCCCTATGGAG
ATCCTATTACGCTTAATTAGGTCTGAAAAGGGTTTGATGTTCTTCCCCGGTGTATCATAT
TTATGGAGGCTTTTTCCTGTAGGAACTTTTGGCTGTAAAACAAAGATCGATCCCACGCTA
AAACTTCTTCCAAATGTATTGTATTCGGGGACACTCACCTTATTCAAAGCTCGTCTGTGA
GTGACTGTTACTTGTCTGAACTGTTTCTCCTGTTTAGCCTTCTGTCTCTGTAACCTGACA
TTCCACTCCCCAGCTTTTCCTATCTTGGAATACAAAGGGCCATCCTTTGGTGGGCTTTGC
TGTAATGGAGCTCCCATGGTAAGGCCACAGTTTGGAGGTGAACCCTGGATTTCATGCTTA
GCATAATGACTAAGGGAATCTGGACAAATGCCTCTTGAGACTCCATCCTCTGGCATCCAG
GACACTCGACCTCTCTCCAGCTCGGAGACAATATCTGGTTTGGAAACCGGAAGCCCCAAA
GAGACCAGGTTCTCATAGTTCTCCAGCATCACCTCCCTGTACGGGCCCTCTGAGCAGGGC
CCAGGTGCCCCACTCCTCCCAGGAGAAGTCCACGGCCACATCCTTGAATGTCACTGACTC
CTGAAAGCTGGTGGGCAGGGACCCAGAAATCATCCCTTCCTCCTCCGTCTCCTCAATGCT
TTTGTCTCATAAAGGGCAGAGTCTTGGAAAGGCAGAATGAGGGCCTACTGTGTGCCGCGT
GATCCCAGGGCTGCAGACGCGTGGTACCTCCTCCATCATCCGCGGTAGCGATCCTTCCCA
GCTGGATGCCAGCTCACAACTTGAGGAGCCTTTGTCAAAGGTGGGGTCACTCGCAACTTT
CCCTAGGTCTCTGGTCCTCACCCCACATCCCTCGGACGCAGCTCCTCCTTTTCCTGCTCT
GCTTGCACAGGCTGGTCACCACTCAAGTGTCCGGCCCTCCTCTGGACCAGACACCTGGCA
GGCTCAGGGTTGCCCCTTTGGTCACACGAGGTCCCTGCATCACGTGAGGGCCCGGAGCCC
CTGAGTCCAGAAATGGCTGGGATGGGGGAAGCGAAAGGGAATAAGCATTTATGTTGCACC
TACTGTGTGCCACCCACAGGGTTAGGCGCTTTACAACTGTGATGGCATCTGATTCTCAAC
AACCACCTGGGGAGGTCGGTGCTGTTGTGATTCCCATTTCATAGACGGGAAAACGCGACA
GACTTAGGTGAAGGGGCTTGCCCAGGGTCTGCATTTGAACCCAGGTCTTCCTGACGTGCA
GCGCTCGGCCCGGCCCCCCGGCCAACAGCAGTGGAGATCTTCCTAAAAGATCTCCTTTTA
GGAAAGGGCTCGATAGAAACTGTCAATCCGGGGGACAGACGGGCCCTCAGGCTGTCACCC
CTCCAAGGCCAAGGCCAAAGCTGGGGGCGGGGTAGTACAGGGTCGCCCTAGACCGAGGTG
GGTCAAGCAGACGCAACGCTCCGCGCAGTGGCCCCGCCTCC
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.332468 polypeptide m.332468:3..881 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources