Locus_10001_Transcript_12/14_Confidence_0.272_Length_723 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_12/14_Confidence_0.272_Length_723
Unique Name Locus_10001_Transcript_12/14_Confidence_0.272_Length_723
Internal ID 24
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 723
Properties
Properties for the feature 'Locus_10001_Transcript_12/14_Confidence_0.272_Length_723' include:
Property Name Value
Expression spleen=0.000231 liver=0.213825 uterus=0 kidney=0 lung=1.20626 heart=0 brain=0.701172 adrenal=0.47962
Sequence
The sequence for this mRNA
TTTCCAGCACTGATGTCATTACATTGCTTCTCCTCCAGTAGGGTATGAATTCTCTGGTGT
TCTATCAGGCTTCCCCAGCGACTGAAGGCTTTACCACATGCATTACATTTGTGGGGCTTC
TCTCCAGTATGAATGCTCTGGTGCTGAGTAAGATATGACCTTCTGCTGAAGGTTTTGTCA
CATTCATTACATTCGTACAGCTTTTCTCCAGTATGGAGTCTACGAAACTGAATGAGGTCT
GAATGGTAACTGAAGGACTTCCTGCACTTATTGTATTTGTAAAGCTTACTCCCTATGGAG
ATCCTATTACGCTTAATTAGGTCTGAAAAGGGTTTGATGTTCTTCCCCGGTGTATCATAT
TTATGGAGGCTTTTTCCTGTAGGAACTTTTGGCTGTAAAACAAAGATCGATCCCACGCTA
AAACTTCTTCCAAATGTATTGTATTCGGGGACACTCACCTTATTCAAAGCTCGTCTGTGA
GTGACTGTTACTTGTCTGAACTGTTTCTCCTGTTTAGCCTTCTGTCTCTGTAACCTGACA
TTCCACTCCCCAGCTTTTCCTATCTTGGAATACAAAGGGCCATCCTTTGGTGGGCTTTGC
TGTAATGGAGCTCCCATGGTAAGGCCACAGTTTGGAGGTGAACCCTGGATTTCATGCTTA
GCATAATGACTAAGGGAATTGAATCATGTGGCTTCTTCCACCCTTCTTGCAGATTCTGTG
CTG
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.332467 polypeptide m.332467:3..617 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources