Locus_10001_Transcript_11/14_Confidence_0.284_Length_2848 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_11/14_Confidence_0.284_Length_2848
Unique Name Locus_10001_Transcript_11/14_Confidence_0.284_Length_2848
Internal ID 21
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 2848
Properties
Properties for the feature 'Locus_10001_Transcript_11/14_Confidence_0.284_Length_2848' include:
Property Name Value
Expression spleen=0.143052 liver=0.001338 uterus=0.186691 kidney=0.045887 lung=0.220647 heart=0.007097 brain=0.151715 adrenal=0.176038
Sequence
The sequence for this mRNA
TTTCCAGCACTGATGTCATTACATTGCTTCTCCTCCAGTAGGGTATGAATTCTCTGGTGT
TCTATCAGGCTTCCCCAGCGACTGAAGGCTTTACCACATGCATTACATTTGTGGGGCTTC
TCTCCAGTATGAATGCTCTGGTGCTGAGTAAGATATGACCTTCTGCTGAAGGTTTTGTCA
CATTCATTACATTCGTACAGCTTTTCTCCAGTATGGAGTCTACGAAACTGAATGAGGTCT
GAATGGTAACTGAAGGACTTCCTGCACTTATTGTATTTGTAAAGCTTACTCCCTATGGAG
ATCCTATTACGCTTAATTAGGTCTGAAAAGGGTTTGATGTTCTTCCCCGGTGTATCATAT
TTATGGAGGCTTTTTCCTGTAGGAACTTTTGGCTGTAAAACAAAGATCGATCCCACGCTA
AAACTTCTTCCAAATGTATTGTATTCGGGGACACTCACCTTATTCAAAGCTCGTCTGTGA
GTGACTGTTACTTGTCTGAACTGTTTCTCCTGTTTAGCCTTCTGTCTCTGTAACCTGACA
TTCCACTCCCCAGCTTTTCCTATCTTGGAATACAAAGGGCCATCCTTTGGTGGGCTTTGC
TGTAATGGAGCTCCCATGGTAAGGCCACAGTTTGGAGGTGAACCCTGGATTTCATGCTTA
GCATAATGACTAAGGGAATCTGAAAGAAATCAGAAAAAGAGAACTATTAGTAGCCACTAA
TCTCTGTGAGGGAGGACACAAACTGCTTTAGGTCTGGACTTCTGGGCCTTCCAGAAAGGA
AAAAGATCCTCATTTTGGGAAAGGTAAAACAAACTCTGTTAAGAGGGAACTGAAGCCCAA
GATAGTCCAGGAGACAGCAGCATACTACCGATGCCAAGATCTGAATTAATGATGTTCCAG
GACACTGAAACCACTTACAGATGTCATTAAAACACAAGAGATTCAGTATAAAACCCAGCT
ATTTTCTTGGCAGACAAAAGGGTGGACAGAATGGAAACAGCAGAAAAATGAACTCAGATA
ATACTCAGTTGGAAAATAACTTTTAAGCTCTGCAGACAAAAGTGAGCAATCTGGAAAACA
GAGCAAGGGAAGAAAGTTTCAGAATTATTGGATTTCCCCAAAACAGTAAAGGGAAGATGA
AGAGACAATGTGGTACGGTGGAAAGACAGCCAGGGTTGGAGTCAGGGGGCCTGGATCGAA
GCCCAGTCCTGCTACTTCGTACCAGCAGGATGTTAAGCAAATCCCTTAACCTCCCTGGGA
TTCATCTCTAAAATAAAGATGTCGGGCTGAATGATCTCCCAGATCTCTCCTCCTCCAAAT
CCCCTCATACTGTCATCCTACAGATCTGATTGATGTATCTCAGGAGTCATAAAGGAAAAA
TATCCCAACATACACAATCAGGAAGAGATCACAAATCAACAGAAGAGAATGCCCAAAAGG
ACTGAAGCACTCATTCAACTTGGACAGACACACAATCCTCATGGATTTCTACAAGGGTGA
CATGACAGAGGGAAAAAACAATAAGAAATGACAGAAGTTGGGACAGAGCCCGAGCTAAGC
CACCCAGGACTTCATTTCCAAATCAGCTTCCCTGCAAAGCTTCTCATCCTGTCAAAAGGC
AAGACATAGTCATTTAAAAGGCCCCGTGAATTTGAGAAATTTGTGGTAGAAAAGACTAAA
CTTAAAACGTGAGGCATTGGGCAGAAGGGGGATCACTGTCCAATTAAACTCCTTTTTATC
AACGACTCAGACAAAATGGGCCAAGCCAATCAAATATGCAAACAACAGAAAGCTGGGACA
GCAAGCTCACCCATCAGATTACAGGATTCACAAAGTTCTCAGGAGGCTGTAATGAGGGGG
TGAAGCAGCAGGGGATAGTGGGAAGAACCCTGGACCAACAGCTCCTAGGGGTTCTTCACC
TCTTTGGTGTCCTGGAGCCCTCTGCAACTAGTACAGCAAACCCGTCTCTAGATCTACATT
CATGACTGAAGGAAATGCCAATAAAGAGGGTCCCTCATCTACCACCCCCAACACCCCTGG
AATAACACGGTCTCCACATTGAAAAGGTTTGGGATTACTTTGTATTTACTTATCTCTATA
CACGTTGTTGCTGCCGCCACCACCCTACTCAGTAAACAGAAGGCTCCTGGAGGACAGAAA
TTGTTTCATTTTTGCCTTTTTACTCCCTGTGTCTATTAGGGTTACATTGCAGGCATTACC
AAATGCTTACTGAATCATGTGGCTTCTTCCACCCTTCTTGCAGATTCTGTGCTGTGCAAA
CAGGAGAGAAGTACAATAGTAACAACGGAATTAAATACTACATCTCACTTCATGTGCCAC
AATTTTATTTAAAAAGCATAAAAAGAATTAGACACAAGCAGCTTTTATCACCATGGTGGA
GGTTTGCCATATTTATATCTAATAAACAAAAGGAAGGAACTACAAAAGAGCAAATAAAGG
AGTTTAATTATAGAAAGAGCTTTTGCACAACAAAAAGCAATGCTTCCAAAATAAAAAAGA
AAGCACAGTGGGAGGGGAAGTTTTCTACATATGCTTCTTTCCATATATGCTTTCCTCCTA
AAAGGAGAAAAAGTCCAAAAATATTCTTAGCAGCAACATTTATAGTAGCAAAAACTTGAA
AACAAGTGGAAACAAATGAATGGCTAAACAAAAGAGAGAAGAAAAATGAGAGTAGAGTGG
AATATTATTACACAATCATTTAGTTCATTTTGTGAAGCACCTGCCCCGGGCCAGGAAGCA
TACCAGGTGCTGGGAGATGTAAAGACAACAGGAAATGGGCCCTCCCTAAAGGAGCATGGG
TAAGAAATGACAGAAATGAAGGAACCAG
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.332465 polypeptide m.332465:3..617 -
m.332466 polypeptide m.332466:2223..2639 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources