Locus_10001_Transcript_10/14_Confidence_0.802_Length_1125 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_10/14_Confidence_0.802_Length_1125
Unique Name Locus_10001_Transcript_10/14_Confidence_0.802_Length_1125
Internal ID 19
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1125
Properties
Properties for the feature 'Locus_10001_Transcript_10/14_Confidence_0.802_Length_1125' include:
Property Name Value
Expression spleen=0.000089 liver=0.113887 uterus=0.577501 kidney=0.153731 lung=0.006816 heart=0.000024 brain=0.475746 adrenal=0.00015
Sequence
The sequence for this mRNA
TTTCCAGCACTGATGTCATTACATTGCTTCTCCTCCAGTAGGGTATGAATTCTCTGGTGT
TCTATCAGGCTTCCCCAGCGACTGAAGGCTTTACCACATGCATTACATTTGTGGGGCTTC
TCTCCAGTATGAATGCTCTGGTGCTGAGTAAGATATGACCTTCTGCTGAAGGTTTTGTCA
CATTCATTACATTCGTACAGCTTTTCTCCAGTATGGAGTCTACGAAACTGAATGAGGTCT
GAATGGTAACTGAAGGACTTCCTGCACTTATTGTATTTGTAAAGCTTACTCCCTATGGAG
ATCCTATTACGCTTAATTAGGTCTGAAAAGGGTTTGATGTTCTTCCCCGGTGTATCATAT
TTATGGAGGCTTTTTCCTGTAGGAACTTTTGGCTGTAAAACAAAGATCGATCCCACGCTA
AAACTTCTTCCAAATGTATTGTATTCGGGGACACTCACCTTATTCAAAGCTCGTCTGTGA
GTGACTGTTACTTGTCTGAACTGTTTCTCCTGTTTAGCCTTCTGTCTCTGTAACCTGACA
TTCCACTCCCCAGCTTTTCCTATCTTGGAATACAAAGGGCCATCCTTTGGTGGGCTTTGC
TGTAATGGAGCTCCCATGGTAAGGCCACAGTTTGGAGGTGAACCCTGGATTTCATGCTTA
GCATAATGACTAAGGGAATCTGGACAAATGCCTCTTGAGACTCCATCCTCTGGCATCCAG
GACACTCGACCTCTCTCCAGCTCGGAGACAATATCTGGTTTGGAAACCGGAAGCCCCAAA
GAGACCAGGTTCTCATAGTTCTCCAGCATCACCTCCCTGTACGGGCCCTCTGAGCAGGGC
CCAGGTGCCCCACTCCTCCCAGGAGAAGTCCACGGCCACATCCTTGAATGTCACTGACTC
CTGAAAGCTGGTGGGCAGGGACCCAGAAATCATCCCTTCCTCCTCCGTCTCCTCAATGCT
TTTGTCTCATAAAGGGCAGAGTCTTGGAAAGGCAGAACTGTGCGTGGCCAAACTGGCCCA
CGAACAAAGAGCGGACCCGACCGACCCCACGAGGAACTGCGCCTGCGCACCGTGAGCCTT
CGAACTACGACTCCCAGAAAGCGTCGAGCTCCGCGGCAGTCCCGG
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.332464 polypeptide m.332464:3..881 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources