Locus_10001_Transcript_1/14_Confidence_0.568_Length_487 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10001_Transcript_1/14_Confidence_0.568_Length_487
Unique Name Locus_10001_Transcript_1/14_Confidence_0.568_Length_487
Internal ID 612075
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 487
Properties
Properties for the feature 'Locus_10001_Transcript_1/14_Confidence_0.568_Length_487' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0.056296 kidney=0 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
TGAATCATGTGGCTTCTTCCACCCTTCTTGCAGATTCTGTGCTGGACAAATGCCTCTTGA
GACTCCATCCTCTGGCATCCAGGACACTCGACCTCTCTCCAGCTCGGAGACAATATCTGG
TTTGGAAACCGGAAGCCCCAAAGAGACCAGGTTCTCATAGTTCTCCAGCATCACCTCCCT
GTACGGGCCCTCTGAGCAGGGCCCAGGTGCCCCACTCCTCCCAGGAGAAGTCCACGGCCA
CATCCTTGAATGTCACTGACTCCTGAAAGCTGGTGGGCAGGGACCCAGAAATCATCCCTT
CCTCCTCCGTCTCCTCAATGCTTTTGTCTCATAAAGGGCAGAGTCTTGGAAAGGCAGAAC
TGTGCGTGGCCAAACTGGCCCACGAACAAAGAGCGGACCCGACCGACCCCACGAGGAACT
GCGCCTGCGCACCGTGAGCCTTCGAACTACGACTCCCAGAAAGCGTCGAGCTCCGCGGCA
GTCCCGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources