Locus_100019_Transcript_1/1_Confidence_0.000_Length_207 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100019_Transcript_1/1_Confidence_0.000_Length_207
Unique Name Locus_100019_Transcript_1/1_Confidence_0.000_Length_207
Internal ID 790718
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 207
Properties
Properties for the feature 'Locus_100019_Transcript_1/1_Confidence_0.000_Length_207' include:
Property Name Value
Expression spleen=1.41638 liver=0.190141 uterus=0 kidney=0.3758 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
GTACGCACACACACAGTCTCACACATATTTACACACATACACACAGAAATAACCTTTTGT
AGGATTGAATACGTAAATATACGTACATATGTGCATATACATAGATATACACACTTGTGT
GTTTGTTTGGTATAGTGGAGAGAACGCTGTGTTTGGGGGTGGCCCCGGCTTCCAGGCCTG
CCCTGGCCCTCCCTGGCTGTGTTTCCT
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources