Locus_100018_Transcript_1/1_Confidence_0.000_Length_493 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100018_Transcript_1/1_Confidence_0.000_Length_493
Unique Name Locus_100018_Transcript_1/1_Confidence_0.000_Length_493
Internal ID 790717
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 493
Properties
Properties for the feature 'Locus_100018_Transcript_1/1_Confidence_0.000_Length_493' include:
Property Name Value
Expression spleen=0.559151 liver=0.144763 uterus=0 kidney=0.054187 lung=0 heart=0.047066 brain=0.103341 adrenal=0.056419
Sequence
The sequence for this mRNA
ATCAGGAATACCACCATTCTGCTGGTAATACAGTCGCCACCTTGGAATCATTCCCAACTC
TTCATTTTCCCTCATCCTTCATAGCCACTCTTTTCCCCCACATCTTGTCAATACTGCCTT
CATATCATCTCTCATATCCACCCCCTCCTCTCCTCTCTCTATGCATGTGATCACCTATGT
AATTCAGGACCTCACCACCTCTTGCTTAGAGTATTGTAAAAGCTTCCTTGTCTCCAGACT
TTCCATTCTCCAATCCTTCATACATACCATGACTAAGGATGTGATAATCACTTTATTTCT
GCCCAGTCAGACCATATCATGTTCAGTTCTGGGCACCGTATTTTAGGAAGGGCATTGATA
AATTGGACTGTGTCTAGAGTAGGGCAACCAGGAGAAAGAAAGGTCCTGAGATTGTGCCAC
ACGAGGACTGGTTGAAAGAACTGGGGATGAGAAGTCTGAGTGGAGATATGATTGCTGGCT
TCAACTGTCTAAA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources