Locus_100017_Transcript_1/1_Confidence_0.000_Length_720 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100017_Transcript_1/1_Confidence_0.000_Length_720
Unique Name Locus_100017_Transcript_1/1_Confidence_0.000_Length_720
Internal ID 790716
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 720
Properties
Properties for the feature 'Locus_100017_Transcript_1/1_Confidence_0.000_Length_720' include:
Property Name Value
Expression spleen=0.033568 liver=0 uterus=0 kidney=0 lung=0 heart=0.63278 brain=0.030188 adrenal=0.032902
Sequence
The sequence for this mRNA
CTGAGTTCAAATCCAGAGTCTGATGCAGACTAGTTGCGTTACCTTGGCCAAATCATTTAA
TCCCACATAGCCTCAGTTTCCCCAGCCATAAAATGGCAATGATATCAAAGCTATCCGCCT
CACAATGTTGGCTCAAATGGTATAATCTCATCCGCTTCCAAAAGGGATGTCCCGCTTCCA
ATCCATCCACCCTTCAAGGAGCTTCCAAAATAATTTTCCTAAATCAGAAGTTTGATGACA
TGATAGCTGTGCTGAATGATTGTTCATGTTTCCTATTCCTCCAGGATGAAAGACAGATTC
CTCAATTTGGCATTCAAACCCCTTTACAGCCTGCCACCTTGATAGGCTTATTTTAAATTT
CTCCCTTTCCCACACTCTATGCTCCAGGCCGACTGACCAGAAGTGAGCATTCCCTCCTAC
CTCCGCACACACAGCTTTGTGCAGGAGGTCCACACTCCTTCCTCATCCCCAGCATCCTTC
AAGGCTCAGCTCAGGGGGAGCTTCCTCCAGGAATCGCATGGCTAGGAGGTTTGGCTTCCT
TCTCAAATTAAAAGTGCTGTGTGTTCCTGTGCACAGCTGGGTGATGGAGTCAGCTCTGGG
CCTGGAGTATCGAGGACCTGAGGCCAAATATGAGCTCAGATACTTCCTAGCTATGTGGCC
ACAGCAAGTCCTTTAGCCTCCGTTTGCCTGAGCTCTCTCATCACCAAAATGGGACTAATA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources