Locus_100015_Transcript_1/1_Confidence_0.000_Length_506 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100015_Transcript_1/1_Confidence_0.000_Length_506
Unique Name Locus_100015_Transcript_1/1_Confidence_0.000_Length_506
Internal ID 790714
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 506
Properties
Properties for the feature 'Locus_100015_Transcript_1/1_Confidence_0.000_Length_506' include:
Property Name Value
Expression spleen=1.05313 liver=0 uterus=0 kidney=0.078017 lung=0 heart=0.099591 brain=0.221268 adrenal=0
Sequence
The sequence for this mRNA
ATACTTTTATTAATGGTGATTAATTCATAAATGTATATAAACAAAGAAACAAGTGAAAGA
AAAAAGGATATTTTGTTAAGTATTTAAAATGTTTATTCTTCTTTACAGTTAATCAGAATT
CTTTTCCCAGGGTCCATAGAGAACTAATAAACTTAGGATTAATCAGCTAATTAATCAAGA
AACATTAAATGTCCTTTACTCAATTAGTAAGGACAAAGAATCATAAAAAACACTATATGT
GATGGCAAATAACTGCTACTGATTTGATGAATGTTCTTTTCAAAAAGCAAAATGGAATTT
ACAGTGATCCTACCTGCCTTACAAGGTTGGTGGGAGGAACACAGAATCTTCTATTTAGAG
CAAGAAGGGACCTCAGAGTTCATGTGGTCCAATCTCCTCATTTTACAAATGAGCTCTATA
AGGTTGAATATGGACCTGCCCAAAGTGGGCACAGGTAATGGAACTGGAATTTTTCAGGTT
TTCTGACTCCCCAAACCAACTGTTCT
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources