Locus_100014_Transcript_1/1_Confidence_0.000_Length_198 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100014_Transcript_1/1_Confidence_0.000_Length_198
Unique Name Locus_100014_Transcript_1/1_Confidence_0.000_Length_198
Internal ID 790713
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 198
Properties
Properties for the feature 'Locus_100014_Transcript_1/1_Confidence_0.000_Length_198' include:
Property Name Value
Expression spleen=1.07594 liver=0 uterus=0 kidney=0.505039 lung=0 heart=0.206361 brain=0 adrenal=0
Sequence
The sequence for this mRNA
CGTCATATTCTCTGAAGGGACAGCCAAGCATCATTTAATCTCTTACTTCTAGGTAGTATC
ACTCATGAACCATTACAGAGATGATAAGTATCCCTTTCGTCTTTAGAGGAGATGCAATAT
GGTGCCCTGGGGAAGGAGACTTGGATTCTAATCTTGTCTCTGTCAATAACCACTTGTGTC
ATCCTGACCAAGTAATTT
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources