Locus_100013_Transcript_1/1_Confidence_0.000_Length_360 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100013_Transcript_1/1_Confidence_0.000_Length_360
Unique Name Locus_100013_Transcript_1/1_Confidence_0.000_Length_360
Internal ID 790712
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 360
Properties
Properties for the feature 'Locus_100013_Transcript_1/1_Confidence_0.000_Length_360' include:
Property Name Value
Expression spleen=0.59153 liver=0.0611 uterus=0 kidney=0.138797 lung=0.279021 heart=0 brain=0.266461 adrenal=0
Sequence
The sequence for this mRNA
AAATTTACGACCACAATGGGTTCTGCAGAAGGCATTAATACACCTTCAATTACCATCACA
GGTTTTCTATTATTTTGTTACCTGCCAATACTTGGTCTATCATTATTAGAATAAATTTAA
TATTAGGAATTGTTACCTAGTTTTTAAGTTAAAATATTACAATTCCCTAATTAGAGGATG
TTTCCTTAGAGTAAATTAAAAGGATACAAGTGGTTTCAGCTATTGTAAAGTCAGACTATC
TACAGTGGAGGGACAACTAAGTTCCTCAGAATTTGAAAGAAAAACAAAAAACCTGCAGAA
TTCTTAATTAGCAAAGAAGCTATTTATGATTAAGTAATAAATGTGTTAGGGAAAGTGAAA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources