Locus_100012_Transcript_1/2_Confidence_0.333_Length_254 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100012_Transcript_1/2_Confidence_0.333_Length_254
Unique Name Locus_100012_Transcript_1/2_Confidence_0.333_Length_254
Internal ID 790710
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 254
Properties
Properties for the feature 'Locus_100012_Transcript_1/2_Confidence_0.333_Length_254' include:
Property Name Value
Expression spleen=1.39805 liver=0 uterus=0 kidney=0 lung=0.322751 heart=0.121736 brain=0 adrenal=0
Sequence
The sequence for this mRNA
TGGAGCTGTTGATAGCTTTTTCATTTGAGACCTCTTTGTGTATATTCTTCAACCATTTGT
CTAGTATAGGCAGTTTATTAATTTCTAAAGGAGAAAAAAATGCCCTCCACATATATTTTG
CATTTTTAGTGGTTTATTTCCAGATATTGGCAAATTATGTTAAATATCTTGTGTTCTTTG
TTCTGTCACATGAGATAGTCACTATCTACTGCTGCTGGAAACTAAGCAGATGCCTACCAA
TTGAGGAATGGCTG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources