Locus_100011_Transcript_1/1_Confidence_0.000_Length_385 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100011_Transcript_1/1_Confidence_0.000_Length_385
Unique Name Locus_100011_Transcript_1/1_Confidence_0.000_Length_385
Internal ID 790709
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 385
Properties
Properties for the feature 'Locus_100011_Transcript_1/1_Confidence_0.000_Length_385' include:
Property Name Value
Expression spleen=0.202135 liver=0 uterus=0 kidney=0 lung=0.277594 heart=0.08431 brain=0 adrenal=0.206034
Sequence
The sequence for this mRNA
GGGAACTCTTCTATATTACTGTTTACTCCAGAGTTCCATTCAGGATTAGACAGTTATTAG
AATCCACCCAAATGGGTTTAGTTATTGAAAAGAACCTTATTATATGATACTTTAAGACCT
CATCCATGGTGTGATGTTTAGCTATACCTTTGTAGAGAAATTTTAATATGTAAGGAAAAT
GATGGCATGCCGGGGTCACCCCAAGCTGTGGTGGGTTACCTCCCTCATGCTGACATTGAA
AAATTGTCGCCTGTCACTCTTCGATTGTATGGTCAGTGAGGAAATTTTTCTTGGGTCCAG
AAAGTATCTTTTCCTCCATCCCTAAAGCAGATATTGCAGCTATCTTTAAATGCATTAGTT
TAGTTTGAAACTCTTCAGATATTCC
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources