Locus_100010_Transcript_1/1_Confidence_0.000_Length_350 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100010_Transcript_1/1_Confidence_0.000_Length_350
Unique Name Locus_100010_Transcript_1/1_Confidence_0.000_Length_350
Internal ID 790708
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 350
Properties
Properties for the feature 'Locus_100010_Transcript_1/1_Confidence_0.000_Length_350' include:
Property Name Value
Expression spleen=0.721986 liver=0 uterus=0 kidney=0.100275 lung=0.101613 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
TGCCTCATGGGGCCCCCAGATGGCCTCTGCCCTTTGAACTGGCCTTCACTGAGAAGACAG
TTACCTTTTCCAAGAGTGTTCCCATAAGAATTTTCTCATGTGTTGGGAAACTGGGTAACC
AGAGGTAAGTGAAGAAGGTTAAATTCTATGTCTCATATTGAACCAGACCAACAATCTTGG
TTAGAGATAAGGTGAACCAGAACCCCTGGGCCCAGTTTAGTGGTCCATATGGACTTAGGT
AAGACCCTAAAGGAAACATCCTCTAGCTACAGATCTACTTTGAACCAAAAAAGTCTTTTG
GGGACCACCATTAAGTGCTTGGACATCGGCACTTGGACATTACACACACA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources