Locus_10000_Transcript_1/1_Confidence_0.600_Length_567 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_10000_Transcript_1/1_Confidence_0.600_Length_567
Unique Name Locus_10000_Transcript_1/1_Confidence_0.600_Length_567
Internal ID 612074
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 567
Properties
Properties for the feature 'Locus_10000_Transcript_1/1_Confidence_0.600_Length_567' include:
Property Name Value
Expression spleen=1.03946 liver=0.174698 uterus=1.14728 kidney=1.35623 lung=0.977029 heart=0.299213 brain=2.6332 adrenal=0.362825
Sequence
The sequence for this mRNA
TTTTGTTTGTTTGTTTTTTTACCTGGAAGGTCTGGATTTTTGGCTATAATATTCCTGGGA
ATTTTCATTTGGGGATTTCTTTCAGAAGATGACTAGTGGATCCTTTCTATTTCCACTTTG
TCCTCTGATTCCAAGAGATTTAAGAGTTTTCTTGATTTCTTGAAATATGATATATAGACT
TCTTTTGTGATATCATTGAGATAGCCAAATTATTCTTAAATTCTTTTTTTCTAAATTTGT
TTTCCAGGTCAGTTGTTTTTGTTATGAGATACTTATATTTTCTTGTAAGTTTTCAGTCTT
TTGGCTCTCTTTTTAAAATTTCTTGATGTTGCATGAAATTATGAGCTTTTCTTTGGTCCA
TTCTAATTTTCAGGGAGTTTTTTCCCCTAGGTAATGTTTTGTTCCTCTTGTTCCAAGCCA
TTAATTTGCTTCCCAATTCTTTCTTCCATAATTCTCATTTCTTTTTCCATGTCTTCCTTT
TGGTGCCCTCATTTATTTTTTTTAATCATTTTTAGCTTTTTTTCCCTTTTTTTTTTTGGC
AAGGCAAAGGGGTGAAGTGACTTGCCC
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources