Locus_100009_Transcript_1/1_Confidence_0.000_Length_594 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100009_Transcript_1/1_Confidence_0.000_Length_594
Unique Name Locus_100009_Transcript_1/1_Confidence_0.000_Length_594
Internal ID 790707
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 594
Properties
Properties for the feature 'Locus_100009_Transcript_1/1_Confidence_0.000_Length_594' include:
Property Name Value
Expression spleen=0.324924 liver=0.024616 uterus=0 kidney=0 lung=0 heart=0.020764 brain=0.193245 adrenal=0.270977
Sequence
The sequence for this mRNA
CATTATAGTATCTCTACTAACATTATCAATATTTCCATAGGAAATAGAACATATGAGGTA
TACCTTGGTCTCACACCAGTGGCTTTAGTTATGAAAATACTGGTCACCAGGAGAAAGGGT
AAATACCTCTGAGTCCCACTGATAAAGGAGGTCAGTTCAGTTCCCAATTCCCCACACGCT
GTCAGATGAGCCCTGAAAGAGGTAGTGGTGTCATAAGAAGTATGGTCTTCCACATTTTTT
GGTTAGGGACAATGAATCCCAATATTCTAGTTCTGAGACCTAGGGACCAATTTAATCTAA
GCAGAGTAATTGCATAATCAGAGTACGTATAGCTTAGGCAGTTCTGTATCAATTCTTGTT
TCTGATCCTATAGATGTTATACTCCAATTCTAATAATAGGGTTCATAGAACTTTAGAATT
AGATAGAAAACTTAGATATCACCTGGCTCGACCCTTTAGTCAACTGACTTGAATTCATCG
AATATTTGCAAATATACCATGTGCAAGGAACTATGTGCTAGATGCTACGGACACAAAGAC
AAAAATAAAAGGCCCTGTTCACGAGGTGCTTATTAGAGGGTTTCTACTGGTGGG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources