Locus_100008_Transcript_2/2_Confidence_0.000_Length_975 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100008_Transcript_2/2_Confidence_0.000_Length_975
Unique Name Locus_100008_Transcript_2/2_Confidence_0.000_Length_975
Internal ID 790706
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 975
Properties
Properties for the feature 'Locus_100008_Transcript_2/2_Confidence_0.000_Length_975' include:
Property Name Value
Expression spleen=0.003868 liver=0 uterus=0 kidney=0.090564 lung=0.244744 heart=0 brain=0 adrenal=0.21085
Sequence
The sequence for this mRNA
TTCCAACCTCATCACTCAACTAAAACAGCTTTTCCCAAAGTTTTTAAAGATACCTTAATT
GCTCATTCTGATGGCCTTCCCTCAGTCTTGATCCTTCTCAGACTGTATATTGCATCACCC
TCTCCTACATTCCATTGCCTTTGTTGTTTTCATGATATTACATGCTTTCTTCTAGCTGTC
TTAACCTGTCTGACAGCCACTTCGGTTTCCTTTTCTTACTTATTCTCATCAAACTTCCTA
ACTGTGGTTGTTCCCTAAAATTTTGGCCTTAGGCCCTCTTCTCCCTCTGCTCTTTCTCTT
TGTGATATCATCAGTTTCCATGGTTTTAACTTTGATCTCTTTGTGTATGACTCACAGATC
TAAATATCTCACTTCAGTGTCTCTCTTGAGCTTCAGTCCTGCATCCCATTGCCTATTGCA
CATTTCCAACTGGATGTCCCAGAGACATGTTAGACTCTTAACATTTCCAAAACAGAACTC
ATTTTCTTTAGCCTTAAATCACCATCTCCTCTTCCAAATTCCCCTATTTCTGTCAAAAGG
CACCACTGCTCTTCCTAAGGATTATTATCCCGGACTCCTCACTCTCCCTCATTCCACTTA
TCCAGTGAGTTGCCAGATCTTGCAATTTCTACATACACAGTGGTCTTCATTGTACCCAGT
TACTTCAGTCCTTATGGCATTCTAGAGTCCCTTTGCCATCCTGTTAGTCTCCAGCTATTC
TGTGTCCTCTGTAGCACAAATGCGGTCTCATTAGGGTAGAGGACAATGGGGCTATAACCT
CGCTAGTCCTAGAAAGATGTTTCTGCTGAAGTCTACAGTTATGTTAGTTATCTGGGTTGC
TATTTCATACAGTCAGCTCATTGAATTTGCCTTCCATTCATCCTCTCTTGTAGTTTTCTG
AGAAATATTTGTCTATGCACACACATAAAACACACACACACAACAATCTGGTACTTAGGA
AATTGATTTTTTTTT
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources