Locus_100008_Transcript_1/2_Confidence_0.667_Length_1232 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100008_Transcript_1/2_Confidence_0.667_Length_1232
Unique Name Locus_100008_Transcript_1/2_Confidence_0.667_Length_1232
Internal ID 790705
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1232
Properties
Properties for the feature 'Locus_100008_Transcript_1/2_Confidence_0.667_Length_1232' include:
Property Name Value
Expression spleen=0.455969 liver=0.019501 uterus=0.020681 kidney=0.027174 lung=0.036411 heart=0.025596 brain=0 adrenal=0.028763
Sequence
The sequence for this mRNA
AGAATGTTTTGTGTGAGGAGCATATCCCCACTTGTTTGGGGAGAACTCGGAGTATATGAA
TGGAGAGTAATATGCCATCCAGCTGGACAGATAGATTTGCTCTGTATAGCAGAGGGCTTT
AAGTATTCAACTGAGAAATTTGTATTTTAGCTTAGAAGCAATAGAAAACCACTAAAGCTT
TGCAAGCAGGGTAGTGAGGTGGGCTTTACTTGCTTCCTCTACTTCCTCAATTTTCACTTA
ATCCTTAGCAGTCTGTCTTCCAACCTCATCACTCAACTAAAACAGCTTTTCCCAAAGTTT
TTAAAGATACCTTAATTGCTCATTCTGATGGCCTTCCCTCAGTCTTGATCCTTCTCAGAC
TGTATATTGCATCACCCTCTCCTACATTCCATTGCCTTTGTTGTTTTCATGATATTACAT
GCTTTCTTCTAGCTGTCTTAACCTGTCTGACAGCCACTTCGGTTTCCTTTTCTTACTTAT
TCTCATCAAACTTCCTAACTGTGGTTGTTCCCTAAAATTTTGGCCTTAGGCCCTCTTCTC
CCTCTGCTCTTTCTCTTTGTGATATCATCAGTTTCCATGGTTTTAACTTTGATCTCTTTG
TGTATGACTCACAGATCTAAATATCTCACTTCAGTGTCTCTCTTGAGCTTCAGTCCTGCA
TCCCATTGCCTATTGCACATTTCCAACTGGATGTCCCAGAGACATGTTAGACTCTTAACA
TTTCCAAAACAGAACTCATTTTCTTTAGCCTTAAATCACCATCTCCTCTTCCAAATTCCC
CTATTTCTGTCAAAAGGCACCACTGCTCTTCCTAAGGATTATTATCCCGGACTCCTCACT
CTCCCTCATTCCACTTATCCAGTGAGTTGCCAGATCTTGCAATTTCTACATACACAGTGG
TCTTCATTGTACCCAGTTACTTCAGTCCTTATGGCATTCTAGAGTCCCTTTGCCATCCTG
TTAGTCTCCAGCTATTCTGTGTCCTCTGTAGCACAAATGCGGTCTCATTAGGGTAGAGGA
CAATGGGGCTATAACCTCGCTAGTCCTAGAAAGATGTTTCTGCTGAAGTCTACAGTTATG
TTAGTTATCTGGGTTGCTATTTCATACAGTCAGCTCATTGAATTTGCCTTCCATTCATCC
TCTCTTGTAGTTTTCTGAGAAATATTTGTCTATGCACACACATAAAACACACACACACAA
CAATCTGGTACTTAGGAAATTGATTTTTTTTT
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources