Locus_100007_Transcript_2/2_Confidence_0.333_Length_759 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100007_Transcript_2/2_Confidence_0.333_Length_759
Unique Name Locus_100007_Transcript_2/2_Confidence_0.333_Length_759
Internal ID 790704
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 759
Properties
Properties for the feature 'Locus_100007_Transcript_2/2_Confidence_0.333_Length_759' include:
Property Name Value
Expression spleen=0 liver=0.009601 uterus=0 kidney=0 lung=0 heart=0 brain=0.0022 adrenal=0.020557
Sequence
The sequence for this mRNA
TAGCAGATGAAAGGAAGTTAATCAGTGAGATCATGACGGAGGTGGAGGGAGTGGGAAGAT
GAGTATGGAGATAGAAGTAACAAGCAGTTTTTTCTTAAAGTTTTCAAGATGTAACACAGT
AGGCTGATCATGAACTTCCTCTGGGACACCTCCATGTTGGTTTAAAATGCAAAGATGTTG
TAGTGAGTTTCCCAAATCACCAGTGGAGAGGCTTCACAAAAAGGACTGTTTCCTCTAAGT
AATAAATATCACAGCTGTTTGAGAAGTGTATGATTCAGGCTCCTTCTCCCTCAGTTTCCT
AGTTCAACCCCTCCTTTTGTTTTCTCAGCTGCCGGATTCTTTTATCTCAAAAAGAAAAAG
ACCAGGGCATCAAAGCAGGAAAGGATCCAAAGAACATTTGTTGTTTTATACATAAGAATA
TCTGGCCAGTTTTGAAGAAATAAGAGAATTCTCCCTAATGTCCTTGATATTTCTGGACCA
GTATAACCTCAGCCTGGATGAGGGAGGTGCGAAAAACTGGGGTGACACATGAAGTTGAAT
GCTAAGTGGAAAGTGGGATGACAGGAGATGGCCACATTAATGAGATTAAATGATTAATGA
GAATAAAAAGTAGAGTTTTAATTTTACCTTTTTGGAAATGTTTTCACATCACTTCCACAG
CAAACCTTTGAGTGGATAGGGCCACAAAGGCTCAGTGATATTAAGTGACTCACCTAAAGT
TACATCACTAATAAATGGAAGGGCTGAGATGAAAGCAAG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources