Locus_100007_Transcript_1/2_Confidence_0.333_Length_859 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100007_Transcript_1/2_Confidence_0.333_Length_859
Unique Name Locus_100007_Transcript_1/2_Confidence_0.333_Length_859
Internal ID 790703
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 859
Properties
Properties for the feature 'Locus_100007_Transcript_1/2_Confidence_0.333_Length_859' include:
Property Name Value
Expression spleen=0.604719 liver=0.008044 uterus=0 kidney=0 lung=0.064603 heart=0 brain=0.090285 adrenal=0.0176
Sequence
The sequence for this mRNA
GTTATTGTTCATATTTAACAGATTAAACTAAGGCTAGGAAGGTTATGACTTGTCCAAAGT
CACAACTATCAATTGTTAGCTCTATTTCTACACTTAAATAAAGCAGATGAAAGGAAGTTA
ATCAGTGAGATCATGACGGAGGTGGAGGGAGTGGGAAGATGAGTATGGAGATAGAAGTAA
CAAGCAGTTTTTTCTTAAAGTTTTCAAGATGTAACACAGTAGGCTGATCATGAACTTCCT
CTGGGACACCTCCATGTTGGTTTAAAATGCAAAGATGTTGTAGTGAGTTTCCCAAATCAC
CAGTGGAGAGGCTTCACAAAAAGGACTGTTTCCTCTAAGTAATAAATATCACAGCTGTTT
GAGAAGTGTATGATTCAGGCTCCTTCTCCCTCAGTTTCCTAGTTCAACCCCTCCTTTTGT
TTTCTCAGCTGCCGGATTCTTTTATCTCAAAAAGAAAAAGACCAGGGCATCAAAGCAGGA
AAGGATCCAAAGAACATTTGTTGTTTTATACATAAGAATATCTGGCCAGTTTTGAAGAAA
TAAGAGAATTCTCCCTAATGTCCTTGATATTTCTGGACCAGTATAACCTCAGCCTGGATG
AGGGAGGTGCGAAAAACTGGGGTGACACATGAAGTTGAATGCTAAGTGGAAAGTGGGATG
ACAGGAGATGGCCACATTAATGAGATTAAATGATTAATGAGAATAAAAAGTAGAGTTTTA
ATTTTACCTTTTTGGAAATGTTTTCACATCACTTCCACAGCAAACCTTTGAGTGGATAGG
GCCACAAAGGCTCAGTGATATTAAGTGACTCACCTAAAGTTACATCACTAATAAATGGAA
GGGCTGAGATGAAAGCAAG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources