Locus_100006_Transcript_1/1_Confidence_0.000_Length_165 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100006_Transcript_1/1_Confidence_0.000_Length_165
Unique Name Locus_100006_Transcript_1/1_Confidence_0.000_Length_165
Internal ID 790702
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 165
Properties
Properties for the feature 'Locus_100006_Transcript_1/1_Confidence_0.000_Length_165' include:
Property Name Value
Expression spleen=5.76204 liver=0 uterus=0 kidney=0 lung=1.44113 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
AGGAGATCCATTTTTCTTGGGAGTGAAAGATAAAAGGAAGGGGGACTCCTAGACCTAATT
AAGATAATTAGCACGTGTTACTTGCCTTCCTTATGGTGTTTAAATTTTGGACATTTATCC
TGGCAGATCAATATGGATGGATAGTCCTGCATCCCAAAGGTTAGC
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources