Locus_100005_Transcript_1/1_Confidence_0.000_Length_365 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100005_Transcript_1/1_Confidence_0.000_Length_365
Unique Name Locus_100005_Transcript_1/1_Confidence_0.000_Length_365
Internal ID 790701
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 365
Properties
Properties for the feature 'Locus_100005_Transcript_1/1_Confidence_0.000_Length_365' include:
Property Name Value
Expression spleen=0.267545 liver=0.043561 uterus=0 kidney=0.089997 lung=0.090252 heart=0.036991 brain=0.089048 adrenal=0.100858
Sequence
The sequence for this mRNA
CTACTTTACAGAGTTAAATAAAGATATGAGCTGGTAATTTCAAGGGATGGCAGGGTCAAG
TGAAAGTCAAATAGGGGGATGCCAGAGGGCGAAAGAAATACTAGGCGAGTCTGCAGCCCT
TGCAGGAAACAATTAAGCCAGTAAACAGGGAGAGACCGAAGATGGGAGAAGGGATAATTG
GGAAATGATGCGATCAAGTGCACAGGCAGAGGGGTTGGCCTTGGCAAGAATGACCATCTT
TTCATTAGACTAAAGAAAGACAGGGGACGATTTCCAAGAGTTATGGGGGGAGGGAGAGAT
AAGGGAGTTCACCGCAGAACTCCCAACTAAGCATCCGTTTGCATTTTAACCCCAGCACAT
CCCAA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources