Locus_100004_Transcript_9/13_Confidence_0.231_Length_5596 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_9/13_Confidence_0.231_Length_5596
Unique Name Locus_100004_Transcript_9/13_Confidence_0.231_Length_5596
Internal ID 17
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 5596
Properties
Properties for the feature 'Locus_100004_Transcript_9/13_Confidence_0.231_Length_5596' include:
Property Name Value
Expression spleen=0.018237 liver=0.008135 uterus=0.007998 kidney=0.002286 lung=0.018803 heart=0.002683 brain=2.47292 adrenal=0.038601
Sequence
The sequence for this mRNA
CCCGCCCCCTGCCCCCCCGGATCTGTAGGGGCTGCAGGAGCATCAGTCACAGAGAGCAGT
AAACGAGGCAACAGCTGCAGCAACACCCGAAGAGACTCCTGCTACATCTCCATCTTCTCC
AGCTCCAGCTCCAGCCTCCTCCCAACCCGGTTCCGACACCACGGACAGCTCCCGGGTTTC
AGTACCGCGGACAGCGCACCGCCCCACCCCCCGCAGTCACTTGCTGGCTGCGGAGCAGTG
AGCTAGCCTAGAGGGAGCAAGGTAAGCTATGCGGGCGGGATGCCCCGGCTCCCGCTCTCC
ATGGCGCTGCTCCTCAGCCTTGGCCTCTTCGGGCTGTTTCCAGGGTTCCTGGCTACAGAT
ACAGAGGAAAGGTTGGTGGAACATCTCCTGGACCCTGCCCGCTACAATAAGCTCATTCGA
CCGGCCACCAATGGCTCTGAGCTGGTGACTGTGCAGCTTACAGTATCGCTAGCCCAGCTC
ATTAGTGTGGAGTGGGAGGATTACCGGCTTACGTGGAAGCCAGAAGAATTCGACAATATG
AAGAAAGTACGGCTCCCTTCCAAGCATATCTGGCTTCCAGATGTTGTCCTCTACAACAAT
GCTGATGGGGTGTATGAGGTCTCCTTCTACTCCAATGCTGTGGTTTCCTATGATGGTAGC
ATCTTCTGGCTTCCACCTGCCATCTACAAGAGTGCCTGCAAGATTGAGGTCAAGCATTTC
CCCTTTGATCAGCAGAATTGTACCATGAAGTTCCGTTCCTGGACCTATGATCGCACAGAA
ATTGACTTGGTACTGAAGAGTGAAGTTGCCAACTTGGATGATTTTACACCTAGTGGTGAA
TGGGACATTGTAGCCTTGCCCGGACGGCGGAATGAGAATCCAGACGACTCCACTTATGTG
GACATCACCTATGACTTCATCATCCGCCGCAAACCTCTCTTCTACACTATCAACCTCATC
ATTCCTTGCATCCTCATCACCTCCCTTGCCATCCTGGTCTTCTACTTGCCTTCTGACTGT
GGTGAGAAGATGACACTCTGCATCTCTGTCCTGCTGGCTCTCACCGTCTTCCTCCTGCTT
ATCTCCAAGATTGTCCCACCCACCTCACTGGATGTGCCGCTGGTCGGCAAGTACCTCATG
TTCACCATGGTACTGGTGACTTTCTCCATTGTCACCAGTGTCTGTGTCCTCAATGTGCAT
CACCGATCACCTACCACCCACACCATGGCCCCTTGGGTCAAAGTTGTCTTCTTGGAGAAG
CTACCTGCTGTCCTCTTCATGAAGCAGCCACGCCAGAACTGTGCCCGGCAGAGGCTAAGG
CAGCGAAGGCGGCAACAGGAGCAGGAAGGTGGTGGGGGGCTCTTCTTCCGAGATGCCCCA
GGGGCCAATTCCTGTACTTGCTTTGTCAACCAGGCCTCTGTCAAGGAGTTTGGTGGAGTT
TTTGGGGCTGAGTCAGCTGAATCAGCCAATGGCTTCCGGGGGCGAGCGGGCCCTGTTGGG
CCGTGTGGCTGTAGGCTCAAGGAGGCAGTCGACGGTGTGCGCTTCATTGCTGATCACATG
AGGAGTGAGGATGATGACCAAAGCGTGAGTGAGGACTGGAAGTATGTTGCTATGGTGATT
GACCGCCTGTTCCTCTGGATCTTTGTCTTTGTCTGTATCTTTGGCACCATCGGCATGTTC
CTGCAGCCGCTTTTCCAGAACTACGCCACCAATACCTTCCTCCACCTGGCCCACCCTGCT
TCCAGCTCCAAGTGAGATCACCGCGTGTCCAGCCCCCAAACCTAAGCCACCTTAGCCCAT
CCATGATGGAAGACCCATGGTAGTGGTGGCGGTGGTGGGGTTTGCTGCAGACAGGGAAGA
GCAGGAGTGAGGAGCTTCCCTCCAGACGCTTACACTCTCTCTTATGCCAGGCTTAAATTC
CAAGCTACTTATGGAACTTGGCTGGTTTGTGCCTCCCCTCTGGTCTCCCCAACCTTTTGT
TGCTCTGGGGCCCTGAAAGCAGCTAGTGGTAAGAAATGCCAGCTGAGAAATAAAGGAGCA
GAGATGGCAGGAGAGGAACGGACTGAAATCAGAACTCCTGTTGGAAGTTTGAAAGACAAA
GAAATGAAAAGGCCTAGAGTCCAAAAGAAGGGGCCTCATTCTCCTCACCAAAATAGATTG
TCTCCAGATCATAAGAAAAACAGGGTGAGGGTGGATTGAAGGGGAGAAAGAAGAGAGAAG
TGTACAGACATAAGCAGGCTTTTCTGGTTCTTGGTTAAGTTGAGCAAATGGTAGGTAGCT
CCAGAGAGTAGGGCATAGCAACTAGAGTCTGTACAACCCTCTTTTCAGAGAACAGACTTT
TGGCTTATACTAACTACTGCTGAGTTTAGCTGCAAGGGATTACAAACTGGTCAGTGCATC
TAAGTCTAAGGGACCTCTGTGTGCCTGTCTGTAGCTTGATACACAAACCCCATGCTGGAG
TGCATTTTTGACCATCCCTCTCCCCCTACTTTCCCTTTTGTAGAGACAGAAAGTTTTTTG
GCACCATCCCACTCTTTGCTTTCTGGGCCCTCTCAGTTTCTGGGATGACAGAAACCTCGA
TCCTACCTTTTGGCTTGTCACTTACCCCAAATGCTGCCACTTCAATCATCCTCATATACC
TTACTCTACCTTGGGATGGAAGGAATGTGAGGGGATCGCTTGGTGTCAGGATGGGCTGAT
CTTACAAAGGCAATCTAGGTACATTTCTAGAATTCCAGGGTTCTAGAATTCGTATTTAGG
GGCTAAGGTCAATGATGTTGCCTCCTTAACTGAAAAAGTACAGAAAATACAAGTATGCAC
AGTCAGTCTCTGACAAACTTTCTGGGAGGCTGAATTGAGTTTTTTAACTGAAGTGACCAA
ATTTCTTGGTTCTCTTCACCTCGTGCAGACCTAGTCTCAGCATCGTGTTGAGGATCTGAG
AGCAGAGAACCAGGAGAGAGGAGGGCAGGACTTCATCTTCTAGCTCTGCCACCTTCACTC
CTAACTACACCTGACCTTATCTCCTGGCGTGACTTTAAGAAGGCCCGACAGCTCCCGTGG
AAGGGAAGAGTCTGCTGATTCCTGCACTCCTTTCTCCATCCCTTTGGACTCTGCCCCCCA
CTTTGCAGTTGACCTGGATTACTGTCTGCAGCTGCTCCAGCCTGATTATAGCTCAGGAGG
TTGGGTGGAGGCCAGAGTGGCATTGGTGGGCCATTGTCCTAGGTAACAGAATACCTCCCC
TCCTCCACTTGGACCCTGTGTTGATTTCAGTTTGCATGGTTTATCCAGGGCTCACTCTGT
GGTCAGCAGAGGGCTGTAAGTGTCAGTCTGTATATGTGATCAGACTTGGGCACTGGTTTC
CAGAGGGCCAATTTTACTTTATACTTCTTCAGAGGTGAAGAGATGAAGCTGAGATCAGAA
GGGGCGGAGATGAAGACATCAATTACCTCGGCAATCCTCTTGCCACTGGCCAAGTAAACA
CCTGTCTTCTAGTACTAGGACCCCCCCCCCACCTCCCATACACACACTTTACCCACCCCA
AAAAGAGATCTGTGGGAGTACAAGATAAGGATAATTACAGGTCACCCACAATTACTTTTT
CTGTGAATTAGTCCCAGAAAATTTCCACTAGACTAGGCTAGCCCCCCTTTGCAAACTTCT
TACTAGTCTGTTCTCAGAATGCAGGCAGAGTTTTAAAAAAAAAATTCCAATGTCCAAATT
TCCAATCCAATAGAAATGATCATTGTTGTCAGCAGGGTCTTGGGTCTCCATCAGTGCAGT
TGGGAGTTTACAGGAGCTCCAGCCAGACTAGAGTAAATTACAGCCACATGGTGGCAGTTT
CAGCACTACTGCCCCCTCCTCCACTCTCCCCACCACGCCCCCGGCCCCGGGGTTGCTGGA
CAGACTTCCACGCCTTGTCTAATCAGTTCTTGCTTTGGACCACCCCTCTCCCTTCCCCTC
CCCTGAGATTTAGGCGGCTGAGTCCGCGACAAGCGCTGCCCTCTCTTGGATTTATGTAGT
CACCACATCCACATTTTGCACCCCGTTTGTGGATAGACCAGAACAAAGCTTCAGAGGTCG
GGGGCGGGGCGGGCTGGGAGTTCCCTAGATCCTGAAAGGGCATTCCCATTTCACAAATGT
GGCCACCGATGCCGAGAAAGGTGGCGTGACAACAGACCTGCACTTCTTGAAGGAAGGGTT
TTGTTTCATTTTTGGTCATCGTTATCACTAGCCCCTAGTAAATGTAGCACACGTTGTAGG
TGCTTAATAAATAGTTGAACTGGCCAGGGTGACACTGGTGATTAAACATCAATTCTGGGA
ATTCAAACCCAGGATGGTATAGTTAGTAGAAGGAACAGCGGCCTGGGAGACGTGGGGCAT
CGGCGGTGGGGTGGCTCCCAGCTCAGGCATTTGAGGCTATGACTTACCGCAAGTTACTCT
TGGCCCTTTCTTTATCAGCAAAGTGAGAGTTAGATTAGATTGGGGGTGCTCTAACTTTTT
TGTCACGGGTTCCCACTTTTGGCAGTCTACTAAAGCTTTTGAACCCCTTATCAGAAAAAG
GTTTGTTGCCCACATTCAGAATTTAAATGTTACTTTCCAGTTGGGTTAGTAAAGATTAAA
GATATACTCCTCCCACCCCCAACCCCATCCAAGTTCTGGGACCCTGAGGAGCCCATGGAC
CCCAGGTTAAGGATCTTTGGATTAAATTCCGTACTCTTTTAATTACCAGGTGCAGGGAAG
CTTTGGAGGAGTTTGAAAGTTGGGCAGGCTCAAAGTTCAGCTCTGGAGGCATAGGAGAGG
GAGGGCTGGACCCCACTGAACAAGCAAGGATGCTCAGATGCAAGAGGTCATAGCAGTTAA
AATACTTATTTTAGGGCTCTATTAGGTTTCTTTGAGCTGCTGTCACTTCTGCCTCTAGGT
CCTCTTGCTCTCTTTTGGAGATACTTTTTCCTTTCCAAGTGATTGTTCTATATCTTGGGA
CTATTGTCTGGTCACTTGCCATCTGCTGAGGATGAGAAGTGAGGAAAGGGTCAGAATACA
GGACGAAAAAGAAAGCTTATAGGAGCTGAGGTAAGCCCACTCAAAAAAACAGGACATCAA
GAATCACTTCCATGTTTCAGCAGGCCTAGCAAAGGAGGGATCATTCGTTGTCTCTGAGGA
GTGAAGGCTATGAACTGTGTGGAGTAGAAAGGTGTCAGCTTAGGTAACAGGAACCTTGCA
GATAATGAAGTAGGAACACAAGAAAATGAGGATGGACCAGATAAGCCCCAGACCTGCTAG
CTTAGTGAGGTGTGGTTATATCCCTACACCACAATACTGAAAGGTCCTCAAGATCTATGC
AATGGTGCTGACTCCTGCTTTTTTCTTTCTAAAGAAATAACTTCCCAATCACAGTTTATT
AACTGCTACTGCCTCAGCCCAGTTAAGAAGAAAGATAGGGGGAAACGCTGGCATTAATCA
GAAACTTGATCAATCTTTGGACTAGATGGTCTCTGAGGTCCCTTCTGGCTTTACTGCAAT
GAACCCTTTATAAAACAGTTCAGTTTTCCCCACCTCATGAGCACACGTTGCGTGTATACA
CACACACACACACACA
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531274 polypeptide m.531274:280..1755 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources