Locus_100004_Transcript_8/13_Confidence_0.346_Length_5648 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_8/13_Confidence_0.346_Length_5648
Unique Name Locus_100004_Transcript_8/13_Confidence_0.346_Length_5648
Internal ID 15
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 5648
Properties
Properties for the feature 'Locus_100004_Transcript_8/13_Confidence_0.346_Length_5648' include:
Property Name Value
Expression spleen=0.015224 liver=0.032022 uterus=0.007292 kidney=0.002218 lung=0.015887 heart=0.002552 brain=13.8101 adrenal=0.607135
Sequence
The sequence for this mRNA
CCCCAGCCCCGCCCCCTGCCCCCCCGGATCTGTAGGGGCTGCAGGAGCATCAGTCACAGA
GAGCAGTAAACGAGGCAACAGCTGCAGCAACACCCGAAGAGACTCCTGCTACATCTCCAT
CTTCTCCAGCTCCAGCTCCAGCCTCCTCCCAACCCGGTTCCGACACCACGGACAGCTCCC
GGGTTTCAGTACCGCGGACAGCGCACCGCCCCACCCCCCGCAGTCACTTGCTGGCTGCGG
AGCAGTGAGCTAGCCTAGAGGGAGCAAGGTAAGCTATGCGGGCGGGATGCCCCGGCTCCC
GCTCTCCATGGCGCTGCTCCTCAGCCTTGGCCTCTTCGGGCTGTTTCCAGGGTTCCTGGC
TACAGATACAGAGGAAAGGTTGGTGGAACATCTCCTGGACCCTGCCCGCTACAATAAGCT
CATTCGACCGGCCACCAATGGCTCTGAGCTGGTGACTGTGCAGCTTACAGTATCGCTAGC
CCAGCTCATTAGTGTGCATGAGCGGGAGCAGATCATGACCACCAATGTCTGGCTGACCCA
GGAGTGGGAGGATTACCGGCTTACGTGGAAGCCAGAAGAATTCGACAATATGAAGAAAGT
ACGGCTCCCTTCCAAGCATATCTGGCTTCCAGATGTTGTCCTCTACAACAATGCTGATGG
GGTGTATGAGGTCTCCTTCTACTCCAATGCTGTGGTTTCCTATGATGGTAGCATCTTCTG
GCTTCCACCTGCCATCTACAAGAGTGCCTGCAAGATTGAGGTCAAGCATTTCCCCTTTGA
TCAGCAGAATTGTACCATGAAGTTCCGTTCCTGGACCTATGATCGCACAGAAATTGACTT
GGTACTGAAGAGTGAAGTTGCCAACTTGGATGATTTTACACCTAGTGGTGAATGGGACAT
TGTAGCCTTGCCCGGACGGCGGAATGAGAATCCAGACGACTCCACTTATGTGGACATCAC
CTATGACTTCATCATCCGCCGCAAACCTCTCTTCTACACTATCAACCTCATCATTCCTTG
CATCCTCATCACCTCCCTTGCCATCCTGGTCTTCTACTTGCCTTCTGACTGTGGTGAGAA
GATGACACTCTGCATCTCTGTCCTGCTGGCTCTCACCGTCTTCCTCCTGCTTATCTCCAA
GATTGTCCCACCCACCTCACTGGATGTGCCGCTGGTCGGCAAGTACCTCATGTTCACCAT
GGTACTGGTGACTTTCTCCATTGTCACCAGTGTCTGTGTCCTCAATGTGCATCACCGATC
ACCTACCACCCACACCATGGCCCCTTGGGTCAAAGTTGTCTTCTTGGAGAAGCTACCTGC
TGTCCTCTTCATGAAGCAGCCACGCCAGAACTGTGCCCGGCAGAGGCTAAGGCAGCGAAG
GCGGCAACAGGAGCAGGAAGGTGGTGGGGGGCTCTTCTTCCGAGATGCCCCAGGGGCCAA
TTCCTGTACTTGCTTTGTCAACCAGGCCTCTGTCAAGGAGTTTGGTGGAGTTTTTGGGGC
TGAGTCAGCTGAATCAGCCAATGGCTTCCGGGGGCGAGCGGGCCCTGTTGGGCCGTGTGG
CTGTAGGCTCAAGGAGGCAGTCGACGGTGTGCGCTTCATTGCTGATCACATGAGGAGTGA
GGATGATGACCAAAGCGTGAGTGAGGACTGGAAGTATGTTGCTATGGTGATTGACCGCCT
GTTCCTCTGGATCTTTGTCTTTGTCTGTATCTTTGGCACCATCGGCATGTTCCTGCAGCC
GCTTTTCCAGAACTACGCCACCAATACCTTCCTCCACCTGGCCCACCCTGCTTCCAGCTC
CAAGTGAGATCACCGCGTGTCCAGCCCCCAAACCTAAGCCACCTTAGCCCATCCATGATG
GAAGACCCATGGTAGTGGTGGCGGTGGTGGGGTTTGCTGCAGACAGGGAAGAGCAGGAGT
GAGGAGCTTCCCTCCAGACGCTTACACTCTCTCTTATGCCAGGCTTAAATTCCAAGCTAC
TTATGGAACTTGGCTGGTTTGTGCCTCCCCTCTGGTCTCCCCAACCTTTTGTTGCTCTGG
GGCCCTGAAAGCAGCTAGTGGTAAGAAATGCCAGCTGAGAAATAAAGGAGCAGAGATGGC
AGGAGAGGAACGGACTGAAATCAGAACTCCTGTTGGAAGTTTGAAAGACAAAGAAATGAA
AAGGCCTAGAGTCCAAAAGAAGGGGCCTCATTCTCCTCACCAAAATAGATTGTCTCCAGA
TCATAAGAAAAACAGGGTGAGGGTGGATTGAAGGGGAGAAAGAAGAGAGAAGTGTACAGA
CATAAGCAGGCTTTTCTGGTTCTTGGTTAAGTTGAGCAAATGGTAGGTAGCTCCAGAGAG
TAGGGCATAGCAACTAGAGTCTGTACAACCCTCTTTTCAGAGAACAGACTTTTGGCTTAT
ACTAACTACTGCTGAGTTTAGCTGCAAGGGATTACAAACTGGTCAGTGCATCTAAGTCTA
AGGGACCTCTGTGTGCCTGTCTGTAGCTTGATACACAAACCCCATGCTGGAGTGCATTTT
TGACCATCCCTCTCCCCCTACTTTCCCTTTTGTAGAGACAGAAAGTTTTTTGGCACCATC
CCACTCTTTGCTTTCTGGGCCCTCTCAGTTTCTGGGATGACAGAAACCTCGATCCTACCT
TTTGGCTTGTCACTTACCCCAAATGCTGCCACTTCAATCATCCTCATATACCTTACTCTA
CCTTGGGATGGAAGGAATGTGAGGGGATCGCTTGGTGTCAGGATGGGCTGATCTTACAAA
GGCAATCTAGGTACATTTCTAGAATTCCAGGGTTCTAGAATTCGTATTTAGGGGCTAAGG
TCAATGATGTTGCCTCCTTAACTGAAAAAGTACAGAAAATACAAGTATGCACAGTCAGTC
TCTGACAAACTTTCTGGGAGGCTGAATTGAGTTTTTTAACTGAAGTGACCAAATTTCTTG
GTTCTCTTCACCTCGTGCAGACCTAGTCTCAGCATCGTGTTGAGGATCTGAGAGCAGAGA
ACCAGGAGAGAGGAGGGCAGGACTTCATCTTCTAGCTCTGCCACCTTCACTCCTAACTAC
ACCTGACCTTATCTCCTGGCGTGACTTTAAGAAGGCCCGACAGCTCCCGTGGAAGGGAAG
AGTCTGCTGATTCCTGCACTCCTTTCTCCATCCCTTTGGACTCTGCCCCCCACTTTGCAG
TTGACCTGGATTACTGTCTGCAGCTGCTCCAGCCTGATTATAGCTCAGGAGGTTGGGTGG
AGGCCAGAGTGGCATTGGTGGGCCATTGTCCTAGGTAACAGAATACCTCCCCTCCTCCAC
TTGGACCCTGTGTTGATTTCAGTTTGCATGGTTTATCCAGGGCTCACTCTGTGGTCAGCA
GAGGGCTGTAAGTGTCAGTCTGTATATGTGATCAGACTTGGGCACTGGTTTCCAGAGGGC
CAATTTTACTTTATACTTCTTCAGAGGTGAAGAGATGAAGCTGAGATCAGAAGGGGCGGA
GATGAAGACATCAATTACCTCGGCAATCCTCTTGCCACTGGCCAAGTAAACACCTGTCTT
CTAGTACTAGGACCCCCCCCCCACCTCCCATACACACACTTTACCCACCCCAAAAAGAGA
TCTGTGGGAGTACAAGATAAGGATAATTACAGGTCACCCACAATTACTTTTTCTGTGAAT
TAGTCCCAGAAAATTTCCACTAGACTAGGCTAGCCCCCCTTTGCAAACTTCTTACTAGTC
TGTTCTCAGAATGCAGGCAGAGTTTTAAAAAAAAAATTCCAATGTCCAAATTTCCAATCC
AATAGAAATGATCATTGTTGTCAGCAGGGTCTTGGGTCTCCATCAGTGCAGTTGGGAGTT
TACAGGAGCTCCAGCCAGACTAGAGTAAATTACAGCCACATGGTGGCAGTTTCAGCACTA
CTGCCCCCTCCTCCACTCTCCCCACCACGCCCCCGGCCCCGGGGTTGCTGGACAGACTTC
CACGCCTTGTCTAATCAGTTCTTGCTTTGGACCACCCCTCTCCCTTCCCCTCCCCTGAGA
TTTAGGCGGCTGAGTCCGCGACAAGCGCTGCCCTCTCTTGGATTTATGTAGTCACCACAT
CCACATTTTGCACCCCGTTTGTGGATAGACCAGAACAAAGCTTCAGAGGTCGGGGGCGGG
GCGGGCTGGGAGTTCCCTAGATCCTGAAAGGGCATTCCCATTTCACAAATGTGGCCACCG
ATGCCGAGAAAGGTGGCGTGACAACAGACCTGCACTTCTTGAAGGAAGGGTTTTGTTTCA
TTTTTGGTCATCGTTATCACTAGCCCCTAGTAAATGTAGCACACGTTGTAGGTGCTTAAT
AAATAGTTGAACTGGCCAGGGTGACACTGGTGATTAAACATCAATTCTGGGAATTCAAAC
CCAGGATGGTATAGTTAGTAGAAGGAACAGCGGCCTGGGAGACGTGGGGCATCGGCGGTG
GGGTGGCTCCCAGCTCAGGCATTTGAGGCTATGACTTACCGCAAGTTACTCTTGGCCCTT
TCTTTATCAGCAAAGTGAGAGTTAGATTAGATTGGGGGTGCTCTAACTTTTTTGTCACGG
GTTCCCACTTTTGGCAGTCTACTAAAGCTTTTGAACCCCTTATCAGAAAAAGGTTTGTTG
CCCACATTCAGAATTTAAATGTTACTTTCCAGTTGGGTTAGTAAAGATTAAAGATATACT
CCTCCCACCCCCAACCCCATCCAAGTTCTGGGACCCTGAGGAGCCCATGGACCCCAGGTT
AAGGATCTTTGGATTAAATTCCGTACTCTTTTAATTACCAGGTGCAGGGAAGCTTTGGAG
GAGTTTGAAAGTTGGGCAGGCTCAAAGTTCAGCTCTGGAGGCATAGGAGAGGGAGGGCTG
GACCCCACTGAACAAGCAAGGATGCTCAGATGCAAGAGGTCATAGCAGTTAAAATACTTA
TTTTAGGGCTCTATTAGGTTTCTTTGAGCTGCTGTCACTTCTGCCTCTAGGTCCTCTTGC
TCTCTTTTGGAGATACTTTTTCCTTTCCAAGTGATTGTTCTATATCTTGGGACTATTGTC
TGGTCACTTGCCATCTGCTGAGGATGAGAAGTGAGGAAAGGGTCAGAATACAGGACGAAA
AAGAAAGCTTATAGGAGCTGAGGTAAGCCCACTCAAAAAAACAGGACATCAAGAATCACT
TCCATGTTTCAGCAGGCCTAGCAAAGGAGGGATCATTCGTTGTCTCTGAGGAGTGAAGGC
TATGAACTGTGTGGAGTAGAAAGGTGTCAGCTTAGGTAACAGGAACCTTGCAGATAATGA
AGTAGGAACACAAGAAAATGAGGATGGACCAGATAAGCCCCAGACCTGCTAGCTTAGTGA
GGTGTGGTTATATCCCTACACCACAATACTGAAAGGTCCTCAAGATCTATGCAATGGTGC
TGACTCCTGCTTTTTTCTTTCTAAAGAAATAACTTCCCAATCACAGTTTATTAACTGCTA
CTGCCTCAGCCCAGTTAAGAAGAAAGATAGGGGGAAACGCTGGCATTAATCAGAAACTTG
ATCAATCTTTGGACTAGATGGTCTCTGAGGTCCCTTCTGGCTTTACTGCAATGAACCCTT
TATAAAACAGTTCAGTTTTCCCCACCTCATGAGCACACGTTGCGTGTATACACACACACA
CACACACA
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531271 polypeptide m.531271:287..1807 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources